347 resultados para parthenocarpic cucumber
Resumo:
Management of cucumber fly (Bactrocera cucumis) has relied heavily on cover sprays of broad spectrum insecticides such as dimethoate and fenthion. Long term access to these insecticides is uncertain, and their use can disrupt integrated pest management programs for other pests such as whitefly, aphids and mites. Application of a protein bait spray for fruit fly control is common practice in tree crops. However, vegetable crops present different challenges as fruit flies are thought to enter these crops only to oviposit, spending the majority of their time in roosting sites outside of the cropping area. Perimeter baiting of non-crop vegetation was developed overseas as a technique for control of melon fly (B. cucurbitae) in cucurbits in Hawaii. More recent work has refined the technique further, with certain types of perimeter vegetation proving more attractive to melon fly than the sorghum or corn crops which are commonly utilised. Trials were performed to investigate the potential of developing a similar system for cucumber fly. Commercially available fruit fly baits were compared for attractiveness to cucumber fly. Eight plant species were evaluated for their relative attractiveness to cucumber flies as roosting sites. Differences were observed in the number of flies feeding at protein bait applied to each of the plants. Results are discussed in the context of the development of a perimeter baiting system for cucumber fly in cucurbit crops.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.
Resumo:
The cytokinins (benzyladenine or benzyladenosine) decreased spermidine and spermine contents despite increasing putrescine content, when administered to isolated cotyledons of Cucumis sativus L. var. Guntur in organ culture. KCl decreased putrescine contents, although marginally increasing polyamine contents. The cytokinins and/or KCl augmented nucleic acid biosynthesis and accumulation, resulting in enhanced growth and differentiation of the isolated cotyledons. These observations show that polyamine accumulation and growth are not always coupled.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
Total tRNA isolated from cucumber cotyledons grown in the presence of radioactive sulfur was analyzed for the occurrence of thionucleosides. The analysis revealed the presence of at least five thionucleosides which were identified as 5-methylaminomethyl-2-thiouridine (mnm5s2U), 2-methylthio-N6-isopentenyladenosine (ms2i6A), 2-methylthio-N6-hydroxyisopentenyladenosine (ms2io6A), 5-methyl-2-thiouridine (m5s2U) and N-[(9-beta-ribofuranosyl-2- methylthiopurine-2-yl)-carbamoyl]-threonine (ms2t6A). A comparison of relative amounts of these thionucleosides in the total tRNAs of dark-, and light-grown cotyledons shows that the relative amounts of ms2i6A, ms2io6A and ms2t6A remain unchanged whereas mnm5s2U increases with a concomitant decrease in the relative amounts of m5s2U after light treatment of dark-grown cotyledons.
Resumo:
A protein which binds specifically to [3H]-zeatin has been isolated from cucumber cotyledons by chromatographic techniques. Its binding to [3H]-zeatin was inhibited remarkably by the addition of non-radioactive cytokinins and the order of inhibition was zeatin > -zeatin riboside > N6-(Delta2-isopentenyl)adenine > N6-(Delta2-isopentenyl)adenosine > N6-benzyl-adenosine > kinetin riboside. This protein behaved as a soluble protein with an apparent molecular size of 43,000 daltons on gel filtration through calibrated Sephadex G-100 column. The dissociation constant, Kd, of the protein-zeatin complex was about 4 × 10–7 M.
Resumo:
Total tRNAs isolated from chloroplasts and etioplasts of cucumber cotyledons were compared with respect to amino acid acceptance, isoacceptor distribution and extent of modification. Aminoacylation of the tRNAs with nine different amino acids studied indicated that the relative acceptor activities of chloroplast total tRNAs for four amino acids are significantly higher than etioplast total tRNAs. Two dimensional polyacrylamide gel electrophoresis (2D-PAGE) of chloroplast total tRNAs separated at least 32 spots, while approximately 41 spots were resolved from etioplast total tRNAs. Comparison of the reversed-phase chromatography (RPC-5) profiles of chloroplast and etioplast leucyl-, lysyl-, phenylalanyl-, and valyl-tRNA species showed no qualitative differences in the elution profiles. However, leucyl-, lysyl- and valyl-tRNA species showed quantitative differences in the relative amounts of the isoaccepting species present in chloroplasts and etioplasts. The analysis of modified nucleotides of total tRNAs from the two plastid types indicated that total tRNA from etioplasts was undermodified with respect to ribothymidine, isopentenyladenosine/hydroxy-isopentenyladenosine, 1-methylguanosine and 2-o-methylguanosine. This indicates that illumination may cause de novo synthesis of chloroplast tRNA-modifying enzymes encoded for by nuclear genes leading to the formation of highly modified tRNAs in chloroplasts. Based on these results, we speculate that the observed decrease in levels of aminoacylation, variations in the relative amounts of certain isoacceptors, and differences in the electrophoretic mobilities of some extra tRNA spots in the etioplast total tRNAs as compared to chloroplast total tRNAs could be due to some partially undermodified etioplast tRNAs. Taken together, the data suggested that the light-induced transformation of etioplasts into chloroplasts is accompanied by increases in the relative levels of some functional chloroplast tRNAs by post transcriptional nucleotide modifications.
Resumo:
From October 2006 to May 2008, The WorldFish Center coordinated a ZoNéCo project to provide support to the Southern and Northern Provinces for decisions about how best to manage the sea cucumber fishery around La Grande Terre. We collected data during underwater population surveys, questionnaire-based interviews with fishers and processors, and landing catch surveys. A core aim was to furnish the Provinces with ‘ballpark’ estimates of the abundance and density of commercially important sea cucumbers on 50 lagoon and barrier reefs. Analysis and synthesis of the ecological and sociological data provide the basis for informed recommendations for fisheries management. Counts of trochus and giant clams on the reefs allow us to also describe the general status of those resources. We propose 13 recommendations for management actions and fishery regulations and advocate an adaptive management approach. This multidisciplinary study should serve as a useful template for assessing other fisheries, and we provide a series of generic ‘lessons learnt’ to aid future programmes. (PDF has 140 pages.)
Resumo:
This study examined the sea cucumber industry in the Philippines through the value chain lens. The intent was to identify effective pathways for the successful introduction of sandfish culture as livelihood support for coastal communities. Value chain analysis is a high-resolution analytical tool that enables industry examination at a detailed level. Previous industry assessments have provided a general picture of the sea cucumber industry in the country. The present study builds on the earlier work and supplies additional details for a better understanding of the industry's status and problems, especially their implications for the Australian Center for International Agricultural Research (ACIAR) funded sandfish project "Culture of sandfish (Holothuria scabra) in Asia- Pacific" (FIS/2003/059). (PDF contains 54 pages)
Resumo:
The sea cucumber fishery in waters off Maine is developing and has recently experienced great increases in landings, corresponding to expanding export markets. Between 1994 and 1996, reported landings ranged from one to three million pounds (Fig. 1). In 1999, reported landings were over eight million pounds and rose to over nine million in 2000 (Feindel1). Like other developing fisheries, we have little information about the biology and ecology of the sea cucumber off Maine, limited data on the fishery, and little knowledge about the key life history processes that characterize its population dynamics. Therefore, we have a limited understanding of the current status of the resource and the impacts the fishery may have on the stock.