965 resultados para macrophage colony-stimulating factor
Resumo:
In Alzheimer disease (AD), neurons are thought to be subjected to the deleterious cytotoxic effects of activated microglia. We demonstrate that binding of amyloid-beta peptide (Aβ) to neuronal Receptor for Advanced Glycation Endproduct (RAGE), a cell surface receptor for Aβ, induces macrophage-colony stimulating factor (M-CSF) by an oxidant sensitive, nuclear factor κB-dependent pathway. AD brain shows increased neuronal expression of M-CSF in proximity to Aβ deposits, and in cerebrospinal fluid from AD patients there was ≈5-fold increased M-CSF antigen (P < 0.01), compared with age-matched controls. M-CSF released by Aβ-stimulated neurons interacts with its cognate receptor, c-fms, on microglia, thereby triggering chemotaxis, cell proliferation, increased expression of the macrophage scavenger receptor and apolipoprotein E, and enhanced survival of microglia exposed to Aβ, consistent with pathologic findings in AD. These data delineate an inflammatory pathway triggered by engagement of Aβ on neuronal RAGE. We suggest that M-CSF, thus generated, contributes to the pathogenesis of AD, and that M-CSF in cerebrospinal fluid might provide a means for monitoring neuronal perturbation at an early stage in AD.
Resumo:
The granulocyte-macrophage colony-stimulating factor (GM-CSF) gene is part of a cytokine gene cluster and is directly linked to a conserved upstream inducible enhancer. Here we examined the in vitro and in vivo functions of the human GM-CSF enhancer and found that it was required for the correctly regulated expression of the GM-CSF gene. An inducible DNase I-hypersensitive site appeared within the enhancer in cell types such as T cells, myeloid cells, and endothelial cells that express GM-CSF, but not in nonexpressing cells. In a panel of transfected cells the human GM-CSF enhancer was activated in a tissue-specific manner in parallel with the endogenous gene. The in vivo function of the enhancer was examined in a transgenic mouse model that also addressed the issue of whether the GM-CSF locus was correctly regulated in isolation from other segments of the cytokine gene cluster. After correction for copy number the mean level of human GM-CSF expression in splenocytes from 11 lines of transgenic mice containing a 10.5-kb human GM-CSF transgene was indistinguishable from mouse GM-CSF expression (99% ± 56% SD). In contrast, a 9.8-kb transgene lacking just the enhancer had a significantly reduced (P = 0.004) and more variable level of activity (29% ± 89% SD). From these studies we conclude that the GM-CSF enhancer is required for the correct copy number-dependent expression of the human GM-CSF gene and that the GM-CSF gene is regulated independently from DNA elements associated with the closely linked IL-3 gene or other members of the cytokine gene cluster.
Resumo:
Immunological functions were analyzed in mice lacking granulocyte/macrophage colony-stimulating factor (GM-CSF). The response of splenic T cells to allo-antigens, anti-mouse CD3 mAb, interleukin 2 (IL-2), or concanavalin A was comparable in GM-CSF +/+ and GM-CSF −/− mice. To investigate the responses of CD8+ and CD4+ T cells against exogenous antigens, mice were immunized with ovalbumin peptide or with keyhole limpet hemocyanin (KLH). Cytotoxic CD8+ T cells with specificity for ovalbumin peptide could not be induced in GM-CSF −/− mice. After immunization with KLH, there was a delay in IgG generation, particularly IgG2a, in GM-CSF −/− mice. Purified CD4+ T cells from GM-CSF −/− mice immunized with KLH showed impaired proliferative responses and produced low amounts of interferon-γ (IFN-γ) and IL-4 when KLH-pulsed B cells or spleen cells were used as antigen presenting cells (APC). When enriched dendritic cells (DC) were used as APC, CD4+ T cells from GM-CSF −/− mice proliferated as well as those from GM-CSF +/+ mice and produced high amounts of IFN-γ and IL-4. To analyze the rescue effect of DC on CD4+ T cells, supernatants from (i) CD4+ T cells cultured with KLH-pulsed DC or (ii) DC cultured with recombinant GM-CSF were transferred to cultures of CD4+ T cells and KLH-pulsed spleen cells from GM-CSF −/− mice. Supernatants from both DC sources contained a factor or factors that restored proliferative responses and IFN-γ production of CD4+ T cells from GM-CSF −/− mice.
Resumo:
Human granulocyte-macrophage colony-stimulating factor (hGM-CSF) induces proliferation and sustains the viability of the mouse interleukin-3-dependent cell line BA/F3 expressing the hGM-CSF receptor. Analysis of the antiapoptosis activity of GM-CSF receptor βc mutants showed that box1 but not the C-terminal region containing tyrosine residues is essential for GM-CSF-dependent antiapoptotic activity. Because βc mutants, which activate Janus kinase 2 but neither signal transducer and activator of transcription 5 nor the MAPK cascade sustain antiapoptosis activity, involvement of Janus kinase 2, excluding the above molecules, in antiapoptosis activity seems likely. GM-CSF activates phosphoinositide-3-OH kinase as well as Akt, and activation of both was suppressed by addition of wortmannin. Interestingly, wortmannin did not affect GM-CSF-dependent antiapoptosis, thus indicating that the phosphoinositide-3-OH kinase pathway is not essential for cell surivival. Analysis using the tyrosine kinase inhibitor genistein and a MAPK/extracellular signal-regulated kinase (ERK) kinase 1 inhibitor, PD98059, indicates that activation of either the genistein-sensitive signaling pathway or the PD98059-sensitive signaling pathway from βc may be sufficient to suppress apoptosis. Wild-type and a βc mutant lacking tyrosine residues can induce expression of c-myc and bcl-xL genes; however, drug sensitivities for activation of these genes differ from those for antiapoptosis activity of GM-CSF, which means that these gene products may be involved yet are inadequate to promote cell survival.
Resumo:
AML1 is involved in the (8;21) translocation, associated with acute myelogenous leukemia (AML)-type M2, which results in the production of the AML1-ETO fusion protein: the amino-terminal 177 amino acids of AML1 and the carboxyl-terminal 575 amino acids of ETO. The mechanism by which AML1-ETO accomplishes leukemic transformation is unknown; however, AML1-ETO interferes with AML1 transactivation of such AML1 targets as the T-cell receptor beta enhancer and the granulocyte-macrophage colony-stimulating factor promoter. Herein, we explored the effect of AML1-ETO on regulation of a myeloid-specific AML1 target, the macrophage colony-stimulating factor (M-CSF) receptor promoter. We found that AML1-ETO and AML1 work synergistically to transactivate the M-CSF receptor promoter, thus exhibiting a different activity than previously described. Truncation mutants within the ETO portion of AML1-ETO revealed the region of ETO necessary for the cooperativity between AML1 and AML1-ETO lies between amino acids 347 and 540. Endogenous M-CSF receptor expression was examined in Kasumi-1 cells, derived from a patient with AML-M2 t(8;21) and the promonocytic cell line U937. Kasumi-1 cells exhibited a significantly higher level of M-CSF receptor expression than U937 cells. Bone marrow from patients with AML-M2 t(8;21) also exhibited a higher level of expression of M-CSF receptor compared with normal controls. The upregulation of M-CSF receptor expression by AML1-ETO may contribute to the development of a leukemic state in these patients.
Resumo:
The idiotype of the Ig expressed by a B-cell malignancy (Id) can serve as a unique tumor-specific antigen and as a model for cancer vaccine development. In murine models of Id vaccination, formulation of syngeneic Id with carrier proteins or adjuvants induces an anti-idiotypic antibody response. However, inducing a potent cell-mediated response to this weak antigen instead would be highly desirable. In the 38C13 lymphoma model, we observed that low doses of free granulocyte/macrophage colony-stimulating factor (GM-CSF) 10,000 units i.p. or locally s.c. daily for 4 days significantly enhanced protective antitumor immunity induced by s.c. Id-keyhole limpet hemocyanin (KLH) immunization. This effect was critically dependent upon effector CD4+ and CD8+ T cells and was not associated with any increased anti-idiotypic antibody production. Lymphocytes from spleens and draining lymph nodes of mice primed with Id-KLH plus GM-CSF, but not with Id-KLH alone, demonstrated significant proliferation to Id in vitro without any biased production of interferon gamma or interleukin 4 protein or mRNA. As a further demonstration of potency, 50% of mice immunized with Id-KLH plus GM-CSF on the same day as challenge with a large s.c. tumor inoculum remained tumor-free at day 80, compared with 17% for Id-KLH alone, when immunization was combined with cyclophosphamide. Taken together, these results demonstrate that GM-CSF can significantly enhance the immunogenicity of a defined self-antigen and that this effect is mediated exclusively by activating the T-cell arm of the immune response.
Resumo:
The c-rel protooncogene encodes a subunit of the NF-kappa B-like family of transcription factors. Mice lacking Rel are defective in mitogenic activation of B and T lymphocytes and display impaired humoral immunity. In an attempt to identify changes in gene expression that accompany the T-cell stimulation defects associated with the loss of Rel, we have examined the expression of cell surface activation markers and cytokine production in mitogen-stimulated Rel-/- T cells. The expression of cell surface markers including the interleukin 2 receptor alpha (IL-2R alpha) chain (CD25), CD69 and L-selectin (CD62) is normal in mitogen-activated Rel-/- T cells, but cytokine production is impaired. In Rel-/- splenic T cell cultures stimulated with phorbol 12-myristate 13-acetate and ionomycin, the levels of IL-3, IL-5, granulocyte- macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma) were only 2- to 3-fold lower compared with normal T cells. In contrast, anti-CD3 and anti-CD28 stimulated Rel-/- T cells, which fail to proliferate, make little or no detectable cytokines. Exogenous IL-2, which restitutes the proliferative response of the anti-CD3- and anti-CD28-treated Rel-/- T cells, restores production of IL-5, TNF-alpha, and IFN-gamma, but not IL-3 and GM-CSF expression to approximately normal levels. In contrast to mitogen-activated Rel-/- T cells, lipopolysaccharide-stimulated Rel-/- macrophages produce higher than normal levels of GM-CSF. These findings establish that Rel can function as an activator or repressor of gene expression and is required by T lymphocytes for production of IL-3 and GM-CSF.
Resumo:
Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.
Resumo:
We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.
Resumo:
Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.
Resumo:
The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.
Resumo:
To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.
Resumo:
Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.
Resumo:
We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.