Chromosomal data of two pholcids (Araneae, Haplogynae): A new diploid number and the first cytogenetical record for the New World Clade

Mesobolivar luteus (Keyserling 1891) and Micropholcus fauroli (Simon 1887) specimens were collected in Ubatuba and Rio Claro, both in the state of São Paulo, Brazil. Mesabolivar luteus showed 2n (male) = 15 = 14 + X and 2n (9) = 16 = 14 + XX in mitotic metaphases and 711 + X in diplotenic cells. During late prophage 1, all bivalents presented a ring shape, evidencing two chiasmata per bivalent. In this species, some diplotenic cells appear in pairs, maybe due to specific characteristics of the intercellular bridges. The metaphases 11 showed n = 7 or n = 8 = 7 + X chromosomes. Micropholcus fauroti evidenced 2n (male) = 17 = 16 + X in spermatogonial metaphases and 8II+X in diplotenic cells, with only one chiasma per bivalent, contrasting with M. luteus. In both species, all chromosomes were metacentrics. The sexual chromosome X was the largest element and appeared as a univalent during meiosis I. These are the first cytogenetical data for the genera Mesabolivar and Micropholcus. Additionally, M. luteus is the first chromosomally analyzed species of the New World clade and the observed diploid number for M. fauroti had not yet been recorded in Pholcidae.

Chromosomal diversification of diploid number, heterochromatin and rDNAs in two species of Phanaeus beetles (Scarabaeidae, Scarabaeinae)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Telomeres in the mouse have large inter-chromosomal variations in the number of T2AG3 repeats

The ultra-long telomeres that have been observed in mice are not in accordance with the concept that critical telomere shortening is related to aging and immortalization. Here, we have used quantitative fluorescence in situ hybridization to estimate (T2AG3)n lengths of individual telomeres in various mouse strains. Telomere lengths were very heterogeneous, but specific chromosomes of bone marrow cells and skin fibroblasts from individual mice had similar telomere lengths. We estimate that the shortest telomeres are around 10 kb in length, indicating that each mouse cell has a few telomeres with (T2AG3)n lengths within the range of human telomeres. These short telomeres may be critical in limiting the replicative potential of murine cells.

Quantitative analysis of chromosomal CGH in human breast tumors associates copy number abnormalities with p53 status and patient survival

We present a general method for rigorously identifying correlations between variations in large-scale molecular profiles and outcomes and apply it to chromosomal comparative genomic hybridization data from a set of 52 breast tumors. We identify two loci where copy number abnormalities are correlated with poor survival outcome (gain at 8q24 and loss at 9q13). We also identify a relationship between abnormalities at two loci and the mutational status of p53. Gain at 8q24 and loss at 5q15-5q21 are linked with mutant p53. The 9q and 5q losses suggest the possibility of gene products involved in breast cancer progression. The analytical techniques are general and also are applicable to the analysis of array-based expression data.

A compendium of myeloma-associated chromosomal copy number abnormalities and their prognostic value.

To obtain a comprehensive genomic profile of presenting multiple myeloma cases we performed high-resolution single nucleotide polymorphism mapping array analysis in 114 samples alongside 258 samples analyzed by U133 Plus 2.0 expression array (Affymetrix). We examined DNA copy number alterations and loss of heterozygosity (LOH) to define the spectrum of minimally deleted regions in which relevant genes of interest can be found. The most frequent deletions are located at 1p (30%), 6q (33%), 8p (25%), 12p (15%), 13q (59%), 14q (39%), 16q (35%), 17p (7%), 20 (12%), and 22 (18%). In addition, copy number-neutral LOH, or uniparental disomy, was also prevalent on 1q (8%), 16q (9%), and X (20%), and was associated with regions of gain and loss. Based on fluorescence in situ hybridization and expression quartile analysis, genes of prognostic importance were found to be located at 1p (FAF1, CDKN2C), 1q (ANP32E), and 17p (TP53). In addition, we identified common homozygously deleted genes that have functions relevant to myeloma biology. Taken together, these analyses indicate that the crucial pathways in myeloma pathogenesis include the nuclear factor-κB pathway, apoptosis, cell-cycle regulation, Wnt signaling, and histone modifications. This study was registered at http://isrctn.org as ISRCTN68454111.

Extraordinary and extensive karyotypic variation: A 48-fold range in chromosome number in the gall-inducing scale insect Apiomorpha (Hemiptera : Coccoidea : Eriococcidae)

Chromosome number reflects strong constraints on karyotype evolution, unescaped by the majority of animal taxa. Although there is commonly chromosomal polymorphism among closely related taxa, very large differences in chromosome number are rare. This study reports one of the most extensive chromosomal ranges yet reported for an animal genus. Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae), an endemic Australian gall-inducing scale insect genus, exhibits an extraordinary 48-fold variation in chromosome number with diploid numbers ranging from 4 to about 192. Diploid complements of all other eriococcids examined to date range only from 6 to 28. Closely related species of Apiomorpha usually have very different karyotypes, to the extent that the variation within some species- groups is as great as that across the entire genus. There is extensive chromosomal variation among populations within 17 of the morphologically defined species of Apiomorpha indicating the existence of cryptic species-complexes. The extent and pattern of karyotypic variation suggests rapid chromosomal evolution via fissions and (or) fusions. It is hypothesized that chromosomal rearrangements in Apiomorpha species may be associated with these insects' tracking the radiation of their speciose host genus, Eucalyptus.

Sequence analysis, chromosomal distribution and long-range organization show that rapid turnover of new and old pBuM satellite DNA repeats leads to different patterns of variation in seven species of the Drosophila buzzatii cluster

We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Using a combination of MLPA kits to detect chromosomal imbalances in patients with multiple congenital anomalies and mental retardation is a valuable choice for developing countries

Conventional karyotyping detects anomalies in 3-15% of patients with multiple congenital anomalies and mental retardation (MCA/MR). Whole-genome array screening (WGAS) has been consistently suggested as the first choice diagnostic test for this group of patients, but it is very costly for large-scale use in developing countries. We evaluated the use of a combination of Multiplex Ligation-dependent Probe Amplification (MLPA) kits to increase the detection rate of chromosomal abnormalities in MCA/MR patients. We screened 261 MCA/MR patients with two subtelomeric and one microdeletion kits. This would theoretically detect up to 70% of all submicroscopic abnormalities. Additionally we scored the de Vries score for 209 patients in an effort to find a suitable cut-off for MLPA screening. Our results reveal that chromosomal abnormalities were present in 87 (33.3%) patients, but only 57 (21.8%) were considered causative. Karyotyping detected 15 abnormalities (6.9%), while MLPA identified 54 (20.7%). Our combined MLPA screening raised the total detection number of pathogenic imbalances more than three times when compared to conventional karyotyping. We also show that using the de Vries score as a cutoff for this screening would only be suitable under financial restrictions. A decision analytic model was constructed with three possible strategies: karyotype, karyotype + MLPA and karyotype + WGAS. Karyotype + MLPA strategy detected anomalies in 19.8% of cases which account for 76.45% of the expected yield for karyotype + WGAS. Incremental Cost Effectiveness Ratio (ICER) of MLPA is three times lower than that of WGAS, which means that, for the same costs, we have three additional diagnoses with MLPA but only one with WGAS. We list all causative alterations found, including rare findings, such as reciprocal duplications of regions deleted in Sotos and Williams-Beuren syndromes. We also describe imbalances that were considered polymorphisms or rare variants, such as the new SNP that confounded the analysis of the 22q13.3 deletion syndrome. (C) 2011 Elsevier Masson SAS. All rights reserved.

High frequency of submicroscopic chromosomal imbalances in patients with syndromic craniosynostosis detected by a combined approach of microsatellite segregation analysis, multiplex ligation-dependent probe amplification and array-based comparative genome hybridisation

We present the first comprehensive study, to our knowledge, on genomic chromosomal analysis in syndromic craniosynostosis. In total, 45 patients with craniosynostotic disorders were screened with a variety of methods including conventional karyotype, microsatellite segregation analysis, subtelomeric multiplex ligation-dependent probe amplification) and whole-genome array-based comparative genome hybridisation. Causative abnormalities were present in 42.2% (19/45) of the samples, and 27.8% (10/36) of the patients with normal conventional karyotype carried submicroscopic imbalances. Our results include a wide variety of imbalances and point to novel chromosomal regions associated with craniosynostosis. The high incidence of pure duplications or trisomies suggests that these are important mechanisms in craniosynostosis, particularly in cases involving the metopic suture.

Wide Dispersal and Possible Multiple Origins of Low-Copy-Number Plasmids in Rickettsia Species Associated with Blood-Feeding Arthropods

Plasmids are mobile genetic elements of bacteria that can impart important adaptive traits, such as increased virulence or antibiotic resistance. We report the existence of plasmids in Rickettsia (Rickettsiales; Rickettsiaceae) species, including Rickettsia akari, ""Candidatus Rickettsia amblyommii,"" R. bellii, R. rhipicephali, and REIS, the rickettsial endosymbiont of Ixodes scapularis. All of the rickettsiae were isolated from humans or North and South American ticks. R. parkeri isolates from both continents did not possess plasmids. We have now demonstrated plasmids in nearly all Rickettsia species that we have surveyed from three continents, which represent three of the four major proposed phylogenetic groups associated with blood-feeding arthropods. Gel-based evidence consistent with the existence of multiple plasmids in some species was confirmed by cloning plasmids with very different sequences from each of two ""Ca. Rickettsia amblyommii"" isolates. Phylogenetic analysis of rickettsial ParA plasmid partitioning proteins indicated multiple parA gene origins and plasmid incompatibility groups, consistent with possible multiple plasmid origins. Phylogenetic analysis of potentially host-adaptive rickettsial small heat shock proteins showed that hsp2 genes were plasmid specific and that hsp1 genes, found only on plasmids of ""Ca. Rickettsia amblyommii,"" R. felis, R. monacensis, and R. peacockii, were probably acquired independently of the hsp2 genes. Plasmid copy numbers in seven Rickettsia species ranged from 2.4 to 9.2 per chromosomal equivalent, as determined by real-time quantitative PCR. Plasmids may be of significance in rickettsial evolution and epidemiology by conferring genetic plasticity and host-adaptive traits via horizontal gene transfer that counteracts the reductive genome evolution typical of obligate intracellular bacteria.

Chromosomal gains and losses in ocular melanoma detected by comparative genomic hybridization in an Australian population-based study

To define the location of potential oncogenes and tumor suppressor genes in ocular melanoma we carried out comparative genomic hybridization (CGH) analysis on a population-based series of 25 formalin-fixed, paraffin-embedded primary tumors comprising 17 choroidal, 2 ciliary body, 4 iris, and 2 conjunctival melanomas. Twelve (48%) of the 25 melanomas showed no chromosomal changes and 13 (52%) had at least one chromosomal gain or loss. The mean number of CGH changes in all tumors was 3.3, with similar mean numbers of chromosomal gains (1.5) and losses (1.8). The highest number of chromosomal changes (i.e., nine) occurred in a conjunctival melanoma and included four changes not observed in tumors at any other ocular site (gains in 22q and 11p and losses in 6p and 17p). The most frequent gains in all primary ocular melanomas were on chromosome arm 8q (69%), 6p (31%) and 8p (23%) and the most frequent losses were on 6q (38%), 10q (23%), and 16q (23%). The most common pairing was gain in 8p and gain in 8q, implying a whole chromosome copy number increase; gains in 8p occurred only in conjunction with gains in 8q. The smallest regions of copy number alteration were mapped to gain of 8q21 and loss of 6q21, 10q21, and 16q22. Sublocalization of these chromosomal changes to single-band resolution should accelerate the identification of genes involved in the genesis of ocular melanoma.

Chromosomal characterization of Pseudonannolene strinatii (Spirostreptida, Pseudonannolenidae)

The chromosomes of the cave millipede Pseudonannolene strinatii Mauriès, 1974 were investigated. The diploid chromosome number was found to be 2n=16, XX/XY; the C-banding technique revealed a large amount of heterochromatin while the silver staining technique (Ag-NOR) evidenced the presence of heteromorphism of the NORs in some cells.

A new species of Urostreptus (Diplopoda, Spirostreptidae): description and chromossome number

This work presents the description and chromosome number of Urostreptus atrobrunneus sp. nov. The genus until now had not been registered yet in the São Paulo State, Brazil. The meiotic analysis showed that the species presents 2n=24, XY. The C-banding revealed large blocks of constitutive heterochromatin and two heteromorphic chromosomal pairs, one of them corresponding to the sexual pair.