997 resultados para bone promoter


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Osteosarcoma, a malignant bone tumor, rapidly destroys the cortical bone. We demonstrated that mouse K7M2 osteosarcoma cells were deficient in osterix (osx), a zinc finger-containing transcription factor required for osteoblasts differentiation and bone formation. These cells formed lytic tumors when injected into the tibia. The destruction of bone is mediated by osteoclasts in osteosarcoma. The less expression of osterix with osteolytic phenotype was also observed in more tumor cell lines. Replacement of osterix in K7M2 cells suppressed lytic bone destruction, inhibited tumor growth in vitro and in vivo, and suppressed lung metastasis in vivo and the migration of K7M2 to lung conditioned medium in vitro. By contrast, inhibiting osterix by vector-based small interfering RNA (siRNA) in two cell lines (Dunn and DLM8) that expressed high levels of osterix converted osteoblastic phenotype to lytic. Recognizing and binding of Receptor Activator of NF-κB (RANK) on osteoclast precursors by its ligand RANKL is the key osteoclastogenic event. Increased RANKL results in more osteoclast activity. We investigated whether K7M2-mediated bone destruction was secondary to an effect on RANKL. The conditioned medium from K7M2 could upregulate RANKL in normal osteoblast MC3T3, which might lead to more osteoclast formation. By contrast, the conditioned medium from K7M2 cells transfected with osx-expressing plasmid did not upregulate RANKL. Furthermore, Interleukin-1alpha (IL-1α) was significantly suppressed following osx transfection. IL-1α increased RANKL expression in MC3T3 cells, suggesting that osx may control RANKL via a mechanism involving IL-1α. Using a luciferase reporter assay, we demonstrated that osx downregulated IL-1α through a transcription-mediated mechanism. Following suppression of osterix in Dunn and DLM8 cells led to enhanced IL-1α promoter activity and protein production. Site-directed mutagenesis and Chromatin immunoprecipitation (ChIP) indicated that osterix downregulated IL-1α through a Sp1-binding site on the IL-1α promoter. These data suggest that osterix is involved in the lytic phenotype of osteosarcoma and that this is mediated via transcriptional repression of IL-1α. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

TGF-β plays an important role in differentiation and tissue morphogenesis as well as cancer progression. However, the role of TGF-β in cancer is complicate. TGF-β has primarily been recognized as tumor suppressor, because it can directly inhibit cell proliferation of normal and premalignant epithelial cell. However, in the last stage of tumor progression, TGF-β functions as tumor promoter to enhance tumor cells metastatic dissemination and expands metastatic colonies. Currently, the mechanism of how TGF-β switches its role from tumor suppressor to promoter still remains elusive. Here we identify that overexpression of 14-3-3ζ inhibits TGF-β’s cell cytostatic program through destabilizing p53 in non-transformed human mammary epithelial cells. Mechanistically, we found that 14-3-3ζ overexpression leads to 14-3-3σ downregulation, thereby activates PI3K/Akt signaling pathway and degrades p53, and further inhibits TGF-β induced p21 expression and cell cytostatic function. In addition, we found that overexpression of 14-3-3ζ promotes TGF-β induced breast cancer cells bone metastatic colonization through stabilizing Gli2, which is an important co-transcriptional factor for p-smad2 to activate PTHrP expression and bone osteolytic effect. Taken together, we reveal a novel mechanism that 14-3-3ζ dictates the tumor suppressor or metastases promoter activities of TGF-β signaling pathway through switching p-smad2 binding partner from p53 to Gli2. The expected results will not only provide us the better understanding of the important role of 14-3-3ζ in the early stage of breast cancer development, but also deeply impact our knowledge of signaling mechanisms underlying the complex roles of TGF-β in cancer, which will give us a more accurate strategy to determine when and how anti-TGF-β targeted therapy might be effective.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The til-1 locus was identified as a common retroviral integration site in virus-accelerated lymphomas of CD2-myc transgenic mice. We now show that viral insertions at til-1 lead to transcriptional activation of PEBP2αA (CBFA1), a transcription factor related to the Drosophila segmentation gene product, Runt. Insertions are upstream and in the opposite orientation to the gene and appear to activate a variant promoter that is normally silent in T cells. Activity of this promoter was detected in rodent osteogenic sarcoma cells and primary osteoblasts, implicating bone as the normal site of promoter activity. The isoforms encoded by the activated gene all encompass the conserved runt DNA-binding domain and share a novel N terminus different from the previously reported PEBP2αA products. Minor products include isoforms with internal deletions due to exon skipping and a novel C-terminal domain unrelated to known runt domain factors. The major isoform expressed from the activated til-1 locus (G1) was found to account for virtually all of the core binding factor activity in nuclear extracts from its corresponding lymphoma cell line. Another member of this gene family, AML1(CBFA2), is well known for its involvement in human hemopoietic tumors. These results provide evidence of a direct oncogenic role for PEBP2αA and indicate that the Myc and Runt family genes can cooperate in oncogenesis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The gene encoding the mouse vitamin D receptor has been cloned. A new exon 1 has been found that changes the numbering established for the human VDR gene. Exons 2 and 3 in the human VDR gene (coding for the zinc fingers 1 and 2, respectively) are named exons 3 and 4 in the mouse vitamin D receptor. The 1.5-kb 5′-flanking region of the new exon 1 was analyzed and revealed the presence of putative cis-acting elements. Despite the absence of a TATA box, this 5′-flanking region contains several characteristics of a GC-rich promoter including four Sp1 sites present in tandem and two CCAAT boxes. Interestingly, the Sp1 site that is the most proximal to the new exon 1 overlaps a perfect site for Krox-20/24. Krox-20 is a transcription factor involved in brain development, and also in bone remodeling. In luciferase reporter gene expression assays, we showed that sequences from this 5′-flanking region elicit high transactivation activity. Furthermore, in the NIH 3T3 cell line, a 3- to 5-fold increase in response to forskolin treatment (an activator of adenylate cyclase and in turn of protein kinase A pathway) was observed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transcriptional silencing of genes transferred into hematopoietic stem cells poses one of the most significant challenges to the success of gene therapy. If the transferred gene is not completely silenced, a progressive decline in gene expression as the mice age often is encountered. These phenomena were observed to various degrees in mouse transplant experiments using retroviral vectors containing a human β-globin gene, even when cis-linked to locus control region derivatives. Here, we have investigated whether ex vivo preselection of retrovirally transduced stem cells on the basis of expression of the green fluorescent protein driven by the CpG island phosphoglycerate kinase promoter can ensure subsequent long-term expression of a cis-linked β-globin gene in the erythroid lineage of transplanted mice. We observed that 100% of mice (n = 7) engrafted with preselected cells concurrently expressed human β-globin and the green fluorescent protein in 20–95% of their RBC for up to 9.5 mo posttransplantation, the longest time point assessed. This expression pattern was successfully transferred to secondary transplant recipients. In the presence of β-locus control region hypersensitive site 2 alone, human β-globin mRNA expression levels ranged from 0.15% to 20% with human β-globin chains detected by HPLC. Neither the proportion of positive blood cells nor the average expression levels declined with time in transplanted recipients. Although suboptimal expression levels and heterocellular position effects persisted, in vivo stem cell gene silencing and age-dependent extinction of expression were avoided. These findings support the further investigation of this type of vector for the gene therapy of human hemoglobinopathies.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mice in which the genes encoding the parathyroid hormone (PTH)-related peptide (PTHrP) or the PTH/PTHrP receptor have been ablated by homologous recombination show skeletal dysplasia due to accelerated endochondral bone formation, and die at birth or in utero, respectively. Skeletal abnormalities due to decelerated chondrocyte maturation are observed in transgenic mice where PTHrP expression is targeted to the growth plate, and in patients with Jansen metaphyseal chondrodysplasia, a rare genetic disorder caused by constitutively active PTH/PTHrP receptors. These and other findings thus indicate that PTHrP and its receptor are essential for chondrocyte differentiation. To further explore the role of the PTH/PTHrP receptor in this process, we generated transgenic mice in which expression of a constitutively active receptor, HKrk-H223R, was targeted to the growth plate by the rat α1 (II) collagen promoter. Two major goals were pursued: (i) to investigate how constitutively active PTH/PTHrP receptors affect the program of chondrocyte maturation; and (ii) to determine whether expression of the mutant receptor would correct the severe growth plate abnormalities of PTHrP-ablated mice (PTHrP−/−). The targeted expression of constitutively active PTH/PTHrP receptors led to delayed mineralization, decelerated conversion of proliferative chondrocytes into hypertrophic cells in skeletal segments that are formed by the endochondral process, and prolonged presence of hypertrophic chondrocytes with delay of vascular invasion. Furthermore, it corrected at birth the growth plate abnormalities of PTHrP−/− mice and allowed their prolonged survival. “Rescued” animals lacked tooth eruption and showed premature epiphyseal closure, indicating that both processes involve PTHrP. These findings suggest that rescued PTHrP−/− mice may gain considerable importance for studying the diverse, possibly tissue-specific role(s) of PTHrP in postnatal development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

AML1 is involved in the (8;21) translocation, associated with acute myelogenous leukemia (AML)-type M2, which results in the production of the AML1-ETO fusion protein: the amino-terminal 177 amino acids of AML1 and the carboxyl-terminal 575 amino acids of ETO. The mechanism by which AML1-ETO accomplishes leukemic transformation is unknown; however, AML1-ETO interferes with AML1 transactivation of such AML1 targets as the T-cell receptor beta enhancer and the granulocyte-macrophage colony-stimulating factor promoter. Herein, we explored the effect of AML1-ETO on regulation of a myeloid-specific AML1 target, the macrophage colony-stimulating factor (M-CSF) receptor promoter. We found that AML1-ETO and AML1 work synergistically to transactivate the M-CSF receptor promoter, thus exhibiting a different activity than previously described. Truncation mutants within the ETO portion of AML1-ETO revealed the region of ETO necessary for the cooperativity between AML1 and AML1-ETO lies between amino acids 347 and 540. Endogenous M-CSF receptor expression was examined in Kasumi-1 cells, derived from a patient with AML-M2 t(8;21) and the promonocytic cell line U937. Kasumi-1 cells exhibited a significantly higher level of M-CSF receptor expression than U937 cells. Bone marrow from patients with AML-M2 t(8;21) also exhibited a higher level of expression of M-CSF receptor compared with normal controls. The upregulation of M-CSF receptor expression by AML1-ETO may contribute to the development of a leukemic state in these patients.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Parathyroid hormone-related peptide (PTHrP) was initially identified as a product of malignant tumors that mediates paraneoplastic hypercalcemia. It is now known that the parathyroid hormone (PTH) and PTHrP genes are evolutionarily related and that the products of these two genes share a common receptor, the PTH/PTHrP receptor. PTHrP and the PTH/PTHrP receptor are widely expressed in both adult and fetal tissues, and recent gene-targeting and disruption experiments have implicated PTHrP as a developmental regulatory molecule. Apparent PTHrP functions include the regulation of endochondral bone development, of hair follicle formation, and of branching morphogenesis in the breast. Herein, we report that overexpression of PTHrP in chondrocytes using the mouse type II collagen promoter induces a novel form of chondrodysplasia characterized by short-limbed dwarfism and a delay in endochondral ossification. This features a delay in chondrocyte differentiation and in bone collar formation and is sufficiently marked that the mice are born with a cartilaginous endochondral skeleton. In addition to the delay, chondrocytes in the transgenic mice initially become hypertrophic at the periphery of the developing long bones rather than in the middle, leading to a seeming reversal in the pattern of chondrocyte differentiation and ossification. By 7 weeks, the delays in chondrocyte differentiation and ossification have largely corrected, leaving foreshortened and misshapen but histologically near-normal bones. These findings confirm a role for PTHrP as an inhibitor of the program of chondrocyte differentiation. PTHrP may function in this regard to maintain the stepwise differentiation of chondrocytes that initiates endochondral ossification in the midsection of endochondral bones early in development and that also permits linear growth at the growth plate later in development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The chloroethylnitrosourea (CNU) alkylating agents are commonly used for cancer chemotherapy, but their usefulness is limited by severe bone marrow toxicity that causes the cumulative depletion of all hematopoietic lineages (pancytopenia). Bone marrow CNU sensitivity is probably due to the inefficient repair of CNU-induced DNA damage; relative to other tissues, bone marrow cells express extremely low levels of the O6-methylguanine DNA methyltransferase (MGMT) protein that repairs cytotoxic O6-chloroethylguanine DNA lesions. Using a simplified recombinant retroviral vector expressing the human MGMT gene under control of the phosphoglycerate kinase promoter (PGK-MGMT) we increased the capacity of murine bone marrow-derived cells to repair CNU-induced DNA damage. Stable reconstitution of mouse bone marrow with genetically modified, MGMT-expressing hematopoietic stem cells conferred considerable resistance to the cytotoxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), a CNU commonly used for chemotherapy. Bone marrow harvested from mice transplanted with PGK-MGMT-transduced cells showed extensive in vitro BCNU resistance. Moreover, MGMT expression in mouse bone marrow conferred in vivo resistance to BCNU-induced pancytopenia and significantly reduced BCNU-induced mortality due to bone marrow hypoplasia. These data demonstrate that increased DNA alkylation repair in primitive hematopoietic stem cells confers multilineage protection from the myelosuppressive effects of BCNU and suggest a possible approach to protecting cancer patients from CNU chemotherapy-related toxicity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The activity of the TRACP promoter has been investigated as a model of gene regulation in osteoclasts. The murine TRACP gene promoter contains potential binding sites for a number of transcription factors in particular, candidate sites for the Ets factor PU.1 and for the microphthalmia transcription factor (MiTF). These are of relevance to osteoclast biology because the PU.1 knockout mouse has an osteopetrotic phenotype, and MiTF, when mutated in the mi/mi mouse, also results in osteopetrosis. The binding sites for both of these factors have been identified, and they have been determined to be functional in regulating TRACP expression. A novel assay system using the highly osteoclastogenic RAW/C4 subclone of the murine macrophage cell line RAW264.7 was used to perform gene expression experiments on macrophage and osteoclast cell backgrounds. We have shown that TRACP expression is a target for regulation by the macrophage/osteoclast transcription factor PU.1 and the osteoclast commitment factor MiTF and that these factors act synergistically in regulating this promoter. This directly links two controlling factors of osteoclast differentiation to the expression of an effector of cell function.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The tartrate-resistant acid phosphatase (TRAP) is present in multiple tissues, including kidney, liver, lung, spleen, and bone. Recent study of (TRAP) gene expression has provided evidence for distinct promoters within the (TRAP) gene, suggesting that the gene has alternative, tissue-preferred mRNA transcripts. Examination of endogenous (TRAP) exon 1B and 1C mRNA transcripts revealed tissue-preferred transcript abundance with increased exon 1B transcripts detected in liver and kidney and increased exon 1C transcripts detected in bone and spleen. In this investigation, we have made transgenic mice that express a marker gene driven by two candidate promoters, designated BC and C, within the (TRAP) gene. The BC and C promoters are 2.2 and 1.6 kb, respectively, measured from the translation initiation site. Evaluation of BC transgenic lines demonstrated robust expression in multiple tissues. In contrast, significant transgene expression was not detected in C transgenic lines. Evaluation of transgene mRNAs in BC transgenic lines revealed that virtually all expression was in the form of B transcripts, suggesting that the tissue-preferred pattern of endogenous (TRAP) was not replicated in the BC transgenic line. Likewise, osteoclastogenic cultures from BC, but not C, transgenic bone marrow cells expressed the transgene following receptor activator of NFkappaB ligand/macrophage colony-stimulating factor stimulation. In conclusion, when compared with the 2.2-kb BC portion of the (TRAP) promoter region, the 1.6-kb C portion does not account for significant gene expression in vivo or in vitro; production of the bone- and spleen-preferred (TRAP) C transcript must depend on regulatory elements outside of the 2.2-kb promoter. As the majority of currently investigated transcription factors that influence transcriptional regulation of osteoclast gene expression bind within the 1.6-kb C portion of the (TRAP) promoter, it is likely that transcription binding sites outside of the 2.2-kb region will have profound effects on regulation of the gene in vivo and in vitro.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A 3.9 kb DNA fragment of human osteocalcin promoter and 3.6 kb DNA fragment of the rat collagen type1a1 promoter linked with visually distinguishable GFP isomers, topaz and cyan, were used for multiplex analysis of osteoblast lineage progression. Three patterns of dual transgene, expression can be appreciated in primary bone cell cultures derived from the transgenic mice and by histology of their corresponding bones. Our data support the interpretation that strong pOBCol3.6GFPcyan alone is found in newly formed osteoblasts, while strong pOBCol3.6GFPcyan and hOC-GFPtpz are present in osteoblasts actively making a new matrix. Osteoblasts expressing strong hOC-GFPtpz and weak pOBCol3.6GF-Pcyan are also present and may or may not be producing mineralized matrix. This multiplex approach reveals the heterogeneity within the mature osteoblast population that cannot be appreciated by current histological methods. It should be useful to identify and isolate populations of cells within an osteoblast lineage as they progress through stages of differentiation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The development of scaffolds based on biomaterials is a promising strategy for Tissue Engineering and cellular regeneration. This work focuses on Bone Tissue Engineering, the aim is to develop electrically tailored biomaterials with different crystalline and electric features, and study their impacts onto cell biological behavior, so as to predict the materials output in the enhancement of bone tissue regeneration. It is accepted that bone exhibits piezoelectricity, a property that has been proved to be involved in bone growth/repair mechanism regulation. In addition electrical stimulations have been proved to influence bone growth and repair. Piezoelectric materials are therefore widely investigated for a potential use in bone tissue engineering. The main goal is the development of novel strategies to produce and employ piezoelectric biomaterials, with detailed knowledge of mechanisms involved in cell-material interaction. In the current work, poly (L-lactic) acid (PLLA), a synthetic semi-crystalline polymer, exhibiting biodegradibility, biocompatibility and piezoelectricity is studied and proposed as a promoter of enhanced tissue regeneration. PLLA has already been approved for implantation in human body by the Food and Drug Administration (FDA), and at the moment it is being used in several clinical strategies. The present study consists of first preparing films with different degrees of crystallinity and characterizing these PLLA films, in terms of surface and structural properties, and subsequently assessing the behavior of cells in terms of viability, proliferation, morphology and mineralization for each PLLA configuration. PLLA films were prepared using the solvent cast technique and submitted to different thermal treatments in order to obtain different degrees of crystallinity. Those platforms were then electrically poled, positively and negatively, by corona discharge in order to tailor their electrical properties. The cellular assays were conducted by using two different osteoblast cell lines grown directly onto the PLLA films:Human osteoblast Hob, a primary cell culture and Human osteosarcoma MG-63 cell line. This thesis gives also a comprehensive introduction to the area of Bone Tissue Engineering and provides a review of the work done in this field in the past until today, in that same field, including the one related with bone’s piezoelectricity. Then the experimental part deals with the effects of the crystallinity degrees and of the polarization in terms of surface properties and cellular bio assays. Three different degrees of crystallinity, and three different polarization conditions were prepared; which results in 9 different configurations under investigation.