Cerebral White Matter Oxidation and Nitrosylation in Young Rodents With Kaolin-Induced Hydrocephalus

Hydrocephalus is associated with reduced blood flow in periventricular white matter. To investigate hypoxic and oxidative damage in the brains of rats with hydrocephalus, kaolin was injected into the cisterna magna of newborn 7- and 21-day-old Sprague-Dawley rats, and ventricle size was assessed by magnetic resonance imaging at 7, 21, and 42 days of age. In-situ evidence of hypoxia in periventricular capillaries and glial cells was shown by pimonidazole hydrochloride binding. Biochemical assay of thiobarbituric acid reaction and immunohistochemical detection of malondialdehyde and 4-hydroxy-2-nonenal indicated the presence of lipid peroxidation in white matter. Biochemical assay of nitrite indicated increased nitric oxide production. Nitrotyrosine immunohistochemistry showed nitrosylated proteins in white matter reactive microglia and astrocytes. Activities of the antioxidant enzymes catalase and glutathione peroxidase were not increased, and altered hypoxia-inducible factor 1 alpha was not detected by quantitative reverse transcription-polymerase chain reaction. Cerebral vascular endothelial growth factor expression determined by quantitative reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay was not changed, but vascular endothelial growth factor immunoreactivity was increased in reactive astrocytes of hydrocephalic white matter. To determine if nitric oxide synthase is involved in the pathogenesis, we induced hydrocephalus in 7-day-old wild-type and neuronal nitric oxide synthase-deficient mice. At 7 days, the wild-type and mutant mice exhibited equally severe ventriculomegaly and no behavioral differences, although increased glial fibrillary acidic protein was less in the mutant mice. We conclude that hypoxia, via peroxidation and nitrosylation, contributes to brain changes in young rodents with hydrocephalus and that compensatory mechanisms are negligible.

Generation of a NG2-EYFP mouse for studying the properties of NG2-expressing cells

A range of vectors were made in which the EYFP gene or the Cre gene were inserted in the start codon of the NG2 gene. The NG2-EYFP vectors were used to generate NG2-EYFP “knockin” mice by homologous recombination. The F1 generation showed lack of EYFP expression, due to NeoR cassette interference. Excision of the NeoR, by breeding the F1 generation to ELLA-Cre mice allowed proper expression of EYFP. NG2-EYFP heterozygous mice were characterized in detail for astrocytic, neurogenic and oligodendrocytic properties through antibody labeling. NG2-EYFP+ cells did not label for the astrocyte marker GFAP, but some cells did express S100 Beta. The cells did not label with any neuronal markers like Beta III tubulin, Neun, and double cortin, but many of the NG2-EYFP+ cells made intimate contacts to the neurons. These contacts are widespread throughout the grey and white matter of the brain. The NG2-EYFP+ cells did label for oligodendrocyte markers like PDGFα-R, NG2, Olig2, O4, and Sox 10. There were a few cells termed phantom cells that did label for NG2, but had no EYFP expression. This could have been caused by improper excision of the NeoR cassette in the F2 generation. The heterozygous mouse is a tool to allow the characterization of the in vivo properties of the NG2+ cells. Breeding of these mice to homozygosity yielded an NG2-knockout mouse, which was also subjected to initial characterization. The NG2-EYFP homozygous showed equivalent cell labeling results to the NG2-EYFP heterozygous mouse, but the phantom cells disappeared in the knockout. The results show that the NG2 cells are a heterogenous population that does not express astrocytic or neuronal markers. The homozygous mouse is an ideal tool to further dissect the properties of the cells, lacking NG2 in vivo.

Gene therapy for a novel mouse model of Canavan disease

Canavan disease (CD) is a rare leukodystrophy caused by loss-of-function mutations in the gene encoding aspartoacylase (ASPA), an oligodendrocyte-enriched enzyme. It is characterised by the accumulation of the ASPA substrate N-acetylaspartate (NAA) in brain, blood and urine, leading to a spongiform vacuolisation of the brain, severe motoric and cognitive impairments and premature death. To date, no therapy is available due to the lack of a gene-transfer system allowing transgene expression in oligodendrocytes (OLs) and the restoration of the missing enzyme. Hence, the aim of this study was to establish a novel gene-transfer system and its preclinical evaluation in a CD animal model.rnIn the first part of this thesis, a novel ASPA mouse mutant was generated. A βgeo cassette (including the genes encoding β-galactosidase and neomycin) flanked by frt sites was inserted into intron 1 of the intact aspa gene. Additionally, exon 2 was flanked by loxP sites for optional conditional deletion of the targeted locus. The resulting ASPA-deficient aspalacZ/lacZ-mouse was found to be an accurate model of CD and an important tool to identify novel aspects of its complex pathology. Homozygous mutants showed a CD-like histopathology, neurological impairment, behavioural deficits as well as a reduced body weight. Additionally, MRI data revealed changes in brain metabolite composition. rnRecombinant adeno-associated viral (rAAV) vectors have become a versatile tool for gene transfer to the central nervous system because they are efficient, non-toxic and replication-deficient. Based on the natural neurotropism of AAV vectors, AAV-based gene delivery has entered the clinics for the treatment of neurodegenerative diseases. However, the lack of AAV vectors with oligodendroglial tropism has precluded gene therapy for leukodystrophies. In the second part of this work, it was shown that the transduction profile of established AAV serotypes can be targeted towards OLs in a transcriptional approach, using the oligodendrocyte-specific myelin basic protein (MBP) promoter to drive transgene expression in OLs.rnIn the last part of this work, the therapeutic efficacy of AAV-mediated aspa gene transfer to OLs of juvenile aspalacZ/lacZ mice was evaluated. AAV-aspa injections into multiple sites of the brain parenchyma resulted in transduction of OLs in the grey and white matter throughout the brain. Histological abnormalities in the brain of ASPA-deficient mice were ameliorated and accompanied by a reduction of NAA levels. Furthermore, the treatment resulted in normalisation of body weight, motor function and nest-building behaviour. These data provide a proof-of-concept for a successful gene therapy of Canavan disease. This might pave the way towards translation into clinical application and serve as the basis for the genetic treatment of other leukodystrophies.

Connexin genes in the mouse and human genome

Gap junctions serve for direct intercellular communication by docking of two hemichannels in adjacent cells thereby forming conduits between the cytoplasmic compartments of adjacent cells. Connexin genes code for subunit proteins of gap junction channels and are members of large gene families in mammals. So far, 17 connexin (Cx) genes have been described and characterized in the murine genome. For most of them, orthologues in the human genome have been found (see White and Paul 1999; Manthey et al. 1999; Teubner et al. 2001; Söhl et al. 2001). We have recently performed searches for connexin genes in murine and human gene libraries available at EMBL/Heidelberg, NCBI and the Celera company that have increased the number of identified connexins to 19 in mouse and 20 in humans. For one mouse connexin gene and two human connexin genes we did not find orthologues in the other genome. Here we present a short overview on distinct connexin genes which we found in the mouse and human genome and which may include all members of this gene family, if no further connexin gene will be discovered in the remaining non-sequenced parts (about 1-5%) of the genomes.

Inhibition of L-type amino acid transport with non-physiological amino acids in the Pahenu2 mouse model of phenylketonuria

Phenylketonuria, an autosomal recessive Mendelian disorder, is one of the most common inborn errors of metabolism. Although currently treated by diet, many suboptimal outcomes occur for patients. Neuropathological outcomes include cognitive loss, white matter abnormalities, and hypo- or demyelination, resulting from high concentrations and/or fluctuating levels of phenylalanine. High phenylalanine can also result in competitive exclusion of other large neutral amino acids from the brain, including tyrosine and tryptophan (essential precursors of dopamine and serotonin). This competition occurs at the blood brain barrier, where the L-type amino acid transporter, LAT1, selectively facilitates entry of large neutral amino acids. The hypothesis of these studies is that certain non-physiological amino acids (NPAA; DL-norleucine (NL), 2-aminonorbornane (NB; 2-aminobicyclo-(2,1,1)-heptane-2-carboxylic acid), α-aminoisobutyrate (AIB), and α-methyl-aminoisobutyrate (MAIB)) would competitively inhibit LAT1 transport of phenylalanine (Phe) at the blood-brain barrier interface. To test this hypothesis, Pah-/- mice (n=5, mixed gender; Pah+/-(n=5) as controls) were fed either 5% NL, 0.5% NB, 5% AIB or 3% MAIB (w/w 18% protein mouse chow) for 3 weeks. Outcome measurements included food intake, body weight, brain LNAAs, and brain monoamines measured via LCMS/MS or HPLC. Brain Phe values at sacrifice were significantly reduced for NL, NB, and MAIB, verifying the hypothesis that these NPAAs could inhibit Phe trafficking into the brain. However, concomitant reductions in tyrosine and methionine occurred at the concentrations employed. Blood Phe levels were not altered indicating no effect of NPAA competitors in the gut. Brain NL and NB levels, measured with HPLC, verified both uptake and transport of NPAAs. Although believed predominantly unmetabolized, NL feeding significantly increased blood urea nitrogen. Pah-/-disturbances of monoamine metabolism were exacerbated by NPAA intervention, primarily with NB (the prototypical LAT inhibitor). To achieve the overarching goal of using NPAAs to stabilize Phe transport levels into the brain, a specific Phe-reducing combination and concentration of NPAAs must be found. Our studies represent the first in vivo use of NL, NB and MAIB in Pah-/- mice, and provide proof-of-principle for further characterization of these LAT inhibitors. Our data is the first to document an effect of MAIB, a specific system A transport inhibitor, on large neutral amino acid transport.

Erythrina abyssinica prevents meningoencephalitis in chronic Trypanosoma brucei brucei mouse model

Human African trypanosomiasis is prevalent in Sub-sahara African countries that lie between 14° North and 29° south of the equator. Sixty million people are at risk of infection. Trypanosoma brucei gambesience occurs in West and Central Africa while Trypanosoma brucei rhodesience occurs in East and Southern Africa. The neurological stage of the disease is characterized by neuroinflammation. About 10% of patients treated with the recommended drug, melarsoprol develop post treatment reactive encephalopathy, which is fatal in 50% of these patients, thus melarsoprol is fatal in 5% of all treated patients. This study was aimed at establishing the potential activity of Erythrina abyssinica in reducing neuroinflammation following infection with Trypanosoma brucei brucei. Swiss white mice were divided into ten groups, two control groups and eight infected groups. Infected mice received either methanol or water extract of Erythrina abyssinica at 12.5, 25, 50 or 100 mg/kg body weight. Parasite counts were monitored in peripheral circulation from the third day post infection up to the end of the study. Brains were processed for histology, immunohistochemistry scanning and transmission electron microscopy. Following infection, trypanosomes were observed in circulation 3 days post-infection, with the parasitaemia occurring in waves. In the cerebrum, typical brain pathology of chronic trypanosomiasis was reproduced. This was exhibited as astrocytosis, perivascular cuffing and infiltration of inflammatory cells into the neuropil. However, mice treated with Erythrina abyssinica water extract exhibited significant reduction in perivascular cuffing, lymphocytic infiltration and astrocytosis in the cerebrum. The methanol extract did not have a significant difference compared to the non-treated group. This study provides evidence of anti-inflammatory properties of Erythrina abyssinica and may support its wide use as a medicinal plant by various communities in Kenya.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Experimental infection model for Sin Nombre hantavirus in the deer mouse (Peromyscus maniculatus)

The relationship between hantaviruses and their reservoir hosts is not well understood. We successfully passaged a mouse-adapted strain of Sin Nombre virus from deer mice (Peromyscus maniculatus) by i.m. inoculation of 4- to 6-wk-old deer mouse pups. After inoculation with 5 ID50, antibodies to the nucleocapsid (N) antigen first became detectable at 14 d whereas neutralizing antibodies were detectable by 7 d. Viral N antigen first began to appear in heart, lung, liver, spleen, and/or kidney by 7 d, whereas viral RNA was present in those tissues as well as in thymus, salivary gland, intestine, white fat, and brown fat. By 14 d nearly all tissues examined displayed both viral RNA and N antigen. We noted no consistent histopathologic changes associated with infection, even when RNA load was high. Viral RNA titers peaked on 21 d in most tissues, then began to decline by 28 d. Infection persisted for at least 90 d. The RNA titers were highest in heart, lung, and brown fat. Deer mice can be experimentally infected with Sin Nombre virus, which now allows provocative examination of the virus-host relationship. The prominent involvement of heart, lung, and brown fat suggests that these sites may be important tissues for early virus replication or for maintenance of the virus in nature.

Expression of membrane-associated carbonic anhydrase XIV on neurons and axons in mouse and human brain

Although long suspected from histochemical evidence for carbonic anhydrase (CA) activity on neurons and observations that CA inhibitors enhance the extracellular alkaline shifts associated with synaptic transmission, an extracellular CA in brain had not been identified. A candidate for this CA was suggested by the recent discovery of membrane CA (CA XIV) whose mRNA is expressed in mouse and human brain and in several other tissues. For immunolocalization of CA XIV in mouse and human brain, we developed two antibodies, one against a secretory form of enzymatically active recombinant mouse CA XIV, and one against a synthetic peptide corresponding to the 24 C-terminal amino acids in the human enzyme. Immunostaining for CA XIV was found on neuronal membranes and axons in both mouse and human brain. The highest expression was seen on large neuronal bodies and axons in the anterolateral part of pons and medulla oblongata. Other CA XIV-positive sites included the hippocampus, corpus callosum, cerebellar white matter and peduncles, pyramidal tract, and choroid plexus. Mouse brain also showed a positive reaction in the molecular layer of the cerebral cortex and granular cellular layer of the cerebellum. These observations make CA XIV a likely candidate for the extracellular CA postulated to have an important role in modulating excitatory synaptic transmission in brain.

Sequence-Specific Interaction between the Disintegrin Domain of Mouse ADAM 3 and Murine Eggs: Role of β1 Integrin-associated Proteins CD9, CD81, and CD98

ADAM 3 is a sperm surface glycoprotein that has been implicated in sperm-egg adhesion. Because little is known about the adhesive activity of ADAMs, we investigated the interaction of ADAM 3 disintegrin domains, made in bacteria and in insect cells, with murine eggs. Both recombinant proteins inhibited sperm-egg binding and fusion with potencies similar to that which we recently reported for the ADAM 2 disintegrin domain. Alanine scanning mutagenesis revealed a critical importance for the glutamine at position 7 of the disintegrin loop. Fluorescent beads coated with the ADAM 3 disintegrin domain bound to the egg surface. Bead binding was inhibited by an authentic, but not by a scrambled, peptide analog of the disintegrin loop. Bead binding was also inhibited by the function-blocking anti-α6 monoclonal antibody (mAb) GoH3, but not by a nonfunction blocking anti-α6 mAb, or by mAbs against either the αv or β3 integrin subunits. We also present evidence that in addition to the tetraspanin CD9, two other β1-integrin-associated proteins, the tetraspanin CD81 as well as the single pass transmembrane protein CD98 are expressed on murine eggs. Antibodies to CD9 and CD98 inhibited in vitro fertilization and binding of the ADAM 3 disintegrin domain. Our findings are discussed in terms of the involvement of multiple sperm ADAMs and multiple egg β1 integrin-associated proteins in sperm-egg binding and fusion. We propose that an egg surface “tetraspan web” facilitates fertilization and that it may do so by fostering ADAM–integrin interactions.

Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes.

A mutation within the obese gene was recently identified as the genetic basis for obesity in the ob/ob mouse. The obese gene product, leptin, is a 16-kDa protein expressed predominantly in adipose tissue. Consistent with leptin's postulated role as an extracellular signaling protein, human embryonic kidney 293 cells transfected with the obese gene secreted leptin with minimal intracellular accumulation. Upon differentiation of 3T3-L1 preadipocytes into adipocytes, the leptin mRNA was expressed concomitant with mRNAs encoding adipocyte marker proteins. A factor(s) present in calf serum markedly activated expression of leptin by fully differentiated 3T3-L1 adipocytes. A 16-hr fast decreased (by approximately 85%) the leptin mRNA level of adipose tissue of lean (ob/+ or +/+) mice but had no effect on the approximately 4-fold higher level in obese (ob/ob) littermates. Since the mutation at the ob locus fails to produce the functional protein, yet its cognate mRNA is overproduced, it appears that leptin is necessary for its own downregulation. Leptin mRNA was also suppressed in adipose tissue of rats during a 16-hr fast and was rapidly induced during a 4-hr refeeding period. Insulin deficiency provoked by streptozotocin also markedly down-regulated leptin mRNA and this suppression was rapidly reversed by insulin. These results suggest that insulin may regulate the expression of leptin.

Aminoglutethimide-induced leucopenia in a mouse model:effects of metabolic and structural determinates

A model of human leucopenia has been developed further in the female mouse. Following daily administration to female mice of 50 mg/kg of the aromatase inhibitor aminoglutethimide, significant falls in platelet and white cell counts occurred after 2 and 3 weeks. At week 4, drug dosage was stopped and the cell counts recovered at the end of that week, although on rechallenge at the beginning of week 5, both platelet and white cell counts fell rapidly. Administration to the mice of structural analogues of aminoglutethimide, such as WSP-3, glutethimide and 4-nitroglutethimide, showed no reductions in platelet and white cell counts. The haemotoxicity of aminoglutethimide over 21 days was unaffected by the presence of either the P-450 inhibitor SKF-525A or the hepatic P-450 inducer phenobarbitone. However, the co-administration of cimetidine abolished the haemotoxicity of aminoglutethimide in terms of platelet and white cell levels. In in vitro studies, both aminoglutethimide and WSP-3 were oxidised to cytotoxic species, although aminoglutethimide was significantly more cytotoxic than WSP-3. The NADPH-dependent covalent binding of 14C aminoglutethimide to mouse microsomes in vitro was significantly reduced by the presence of cimetidine. The activation of the compound to reactive species in vitro, the inhibitory effects of cimetidine in vivo and in vitro, as well as the rapid fall in the in vivo white cell count on rechallenge with aminoglutethimide suggest that this model illustrates a form of leucopenia which may be related to hapten formation and subsequent immune-mediated platelet and white cell lysis. © 2003 Elsevier B.V. All rights reserved.