Nucleotide sequence of initiator tRNA from Mycobacterium smegmatis

Abstract is not available.

First complete genome sequence of a capsicum chlorosis tospovirus isolate from Australia with an unusually large S RNA intergenic region

The first complete genome sequence of capsicum chlorosis virus (CaCV) from Australia was determined using a combination of Illumina HiSeq RNA and Sanger sequencing technologies. Australian CaCV had a tripartite genome structure like other CaCV isolates. The large (L) RNA was 8913 nucleotides (nt) in length and contained a single open reading frame (ORF) of 8634 nt encoding a predicted RNA-dependent RNA polymerase (RdRp) in the viral-complementary (vc) sense. The medium (M) and small (S) RNA segments were 4846 and 3944 nt in length, respectively, each containing two non-overlapping ORFs in ambisense orientation, separated by intergenic regions (IGR). The M segment contained ORFs encoding the predicted non-structural movement protein (NSm; 927 nt) and precursor of glycoproteins (GP; 3366 nt) in the viral sense (v) and vc strand, respectively, separated by a 449-nt IGR. The S segment coded for the predicted nucleocapsid (N) protein (828 nt) and non-structural suppressor of silencing protein (NSs; 1320 nt) in the vc and v strand, respectively. The S RNA contained an IGR of 1663 nt, being the largest IGR of all CaCV isolates sequenced so far. Comparison of the Australian CaCV genome with complete CaCV genome sequences from other geographic regions showed highest sequence identity with a Taiwanese isolate. Genome sequence comparisons and phylogeny of all available CaCV isolates provided evidence for at least two highly diverged groups of CaCV isolates that may warrant re-classification of AIT-Thailand and CP-China isolates as unique tospoviruses, separate from CaCV.

The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1

While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1).

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Draft genome sequence of caloramator mitchellensis, a thermoanaerobe isolated from the waters of the Great Artesian Basin

The genome sequence of Caloramator mitchellensis strain VF08, a rod-shaped, heterotrophic, strictly anaerobic bacterium iso-lated from the free-flowing waters of a Great Artesian Basin (GAB) bore well located in Mitchell, an outback Queensland town in Australia, is reported here. The analysis of the 2.42-Mb genome sequence indicates that the attributes of the genome are consistent with its physiological and phenotypic traits.

Azospirillum lipoferum tRNAs: Fractionation and identification of tRNA species and the nucleotide sequence of tRNA(Asn) (QUU)

Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.

Complete genome sequence of a novel zantedeschia mild mosaic virus isolate: The first report from Australia and from Alocasia sp

The complete genome of an Australian isolate of zantedeschia mild mosaic virus (ZaMMV) causing mosaic symptoms on Alocasia sp. (designated ZaMMVAU) was cloned and sequenced. The genome comprises 9942 nucleotides (excluding the poly-A tail) and encodes a polyprotein of 3167 amino acids. The sequence is most closely related to a previously reported ZaMMV isolate from Taiwan (ZaMMV-TW), with 82 and 86 % identity at the nucleotide and amino acid level, respectively. Unlike the amino acid sequence of ZaMMV-TW, however, ZaMMV-AU does not contain a polyglutamine stretch at the N-terminus of the coat-protein-coding region upstream of the DAG motif. This is the first report of ZaMMV from Australia and from Alocasia sp.

Complete genome sequence of Colocasia bobone disease-associated virus, a putative cytorhabdovirus infecting taro

We report the first genome sequence of a Colocasia bobone disease-associated virus (CBDaV) derived from bobone-affected taro [Colocasia esculenta L. Schott] from Solomon Islands. The negative-strand RNA genome is 12,193 nt long, with six major open reading frames (ORFs) with the arrangement 3′-N-P-P3-M-G-L-5′. Typical of all rhabdoviruses, the 3′ leader and 5′ trailer sequences show complementarity to each other. Phylogenetic analysis indicated that CBDaV is a member of the genus Cytorhabdovirus, supporting previous reports of virus particles within the cytoplasm of bobone-infected taro cells. The availability of the CBDaV genome sequence now makes it possible to assess the role of this virus in bobone, and possibly alomae disease of taro and confirm that this sequence is that of Colocasia bobone disease virus (CBDV).

Amino acid sequence of the winged bean (Psophocarpus tetragonolobus) basic lectin. Adenine binding and identification of the active-site tryptophan residue

The complete amino acid sequence of winged bean basic agglutinin (WBA I) was obtained by a combination of manual and gas-phase sequencing methods. Peptide fragments for sequence analyses were obtained by enzymatic cleavages using trypsin and Staphylococcus aureus V8 endoproteinase and by chemical cleavages using iodosobenzoic acid, hydroxylamine, and formic acid. COOH-terminal sequence analysis of WBA I and other peptides was performed using carboxypeptidase Y. The primary structure of WBA I was homologous to those of other legume lectins and more so to Erythrina corallodendron. Interestingly, the sequence shows remarkable identities in the regions involved in the association of the two monomers of E. corallodendron lectin. Other conserved regions are the double metal-binding site and residues contributing to the formation of the hydrophobic cavity and the carbohydrate-binding site. Chemical modification studies both in the presence and absence of N-acetylgalactosamine together with sequence analyses of tryptophan-containing tryptic peptides demonstrate that tryptophan 133 is involved in the binding of carbohydrate ligands by the lectin. The location of tryptophan 133 at the active center of WBA I for the first time subserves to explain a role for one of the most conserved residues in legume lectins.

Nucleotide-sequence of 5S RNA from mycobacterium-smegmatis

32P labelled 5S RNA isolated fromMycobacterium smegmatis was digested withT 1 and pancreatic ribonucleases separately and fingerprinted by two dimensional high voltage electrophoresis on thin-layer DEAE-cellulose plates. The radioactive spots were sequenced and their molar yields were determined. The chain length of the 5S RNA was found to be 120. It showed resemblances to both prokaryotic and eukaryotic 5S RNAs.

Nucleotide sequence of the 3terminal region of belladonna mottle virus (renamed Physalis mottle virus) RNA and analysis of the evolutionary relationships among tymoviral coat proteins

The 3' terminal 1255 nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3' terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addiition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

A new classification and linear sequence of extant gymnosperms

A new classification and linear sequence of the gymnosperms based on previous molecular and morphological phylogenetic and other studies is presented. Currently accepted genera are listed for each family and arranged according to their (probable) phylogenetic position. A full synonymy is provided, and types are listed for accepted genera. An index to genera assists in easy access to synonymy and family placement of genera.