Syntheses, X-ray structure and properties of (5-cyclopentadienyl)ruthenium(II) complexes of pyridyl-2-hydrazone ligands

Complexes of the formulae [(-Cp)Ru(PPh3)(2-PPH)]Cl and [(Cp)Ru(PPh3) (py)(1-PPH)]Cl were prepared by reacting pyridyl-2-phenylhydrazone [PPH, C5H4N-2-CH=NNHPh] with (-Cp)Ru(PPh3)2Cl and (-Cp)Ru(PPh3)(py)Cl, respectively. In these complexes the PPH ligand displays bidentate chelating and unidentate modes of bonding. The molecular structure of [(-Cp)Ru(PPh3)(2-PPH)](ClO4)·CH2Cl2 was determined by X-ray crystallography. In this complex the metal is bonded to the N-pyridyl and N-imine atoms of the chelating ligand. 1H NMR spectral data suggests that PPH is bonded to ruthenium through the pyridine moiety of the PPH ligand in [(η-Cp)Ru(PPh3)(py)(η1-PPH)]Cl.

Synthesis, X-ray structure and properties of (eta(6)-p-cymene)ruthenium(II) Schiff-base complexes of vinylpyridine and vinylimidazole ligands

Complexes of the formulation [(eta(6)-p-cymene)Ru(O-2-C6H4-CH=NC6H4-4-CH3)(L)](ClO4), where L is gamma-picoline, 4-vinylpyridine, 1-methylimidazole and 1-vinylimidazole have been prepared and characterised. The molecular structure of the vinylpyridine adduct has been determined by X-ray crystallography. The crystal belongs to the monoclinic space group P2(1) with the following cell dimensions for the C31H33CIN2O5Ru(M = 650.11): a = 10.890(2)Angstrom, b = 22.295(9)Angstrom, c = 12.930(2)Angstrom, beta = 109.30(2)degrees(3), V = 2964(l)Angstrom 3, Z = 4; D-c = 1.457g cm(-3), lambda(Mo-K alpha) = 0.7107 Angstrom; mu(Mo-K alpha)= 6.61 cm(-1); T = 293 K; R = 0.0359 (wR(2) = 0.0981) for 4819 reflections with I > 2 sigma(I). The structure shows the non-bonding nature of the double bond of the 4-vinylpyridine ligand in the complex in which the metal is bonded to the eta(6)-p-cymene, the N, O-bidentate chelating schiff-base and the unidentate N-donor pyridine ligands.

Synthesis, crystal structure and catalytic properties of (p-cymene)ruthenium(II) azophenol complexes: azophenyl to azophenol conversion by oxygen insertion to a ruthenium---carbon bond

Azophenol complexes of formulation [(η6-p-cymene)RuCl(Ln)] (1–6, n=1–6) were prepared by two synthetic methods involving either an oxygen insertion to the Ru---C bond in cycloruthenated precursors forming complexes 1 and 2 or from the reaction of [{(η6-p-cymene)RuCl}2(μ-Cl)2] with azophenol ligands (HL3–HL6) in the presence of sodium carbonate in CH2Cl2. The molecular structure of the 1-(phenylazo)-2-naphthol complex has been determined by X-ray crystallography. The complex has a η6-p-cymene group, a chloride and a bidentate N,O-donor azophenol ligand. The complexes have been characterized from NMR spectral data. The catalytic activity of the complexes has been studied for the conversion of acetophenone to the corresponding alcohol in the presence of KOH and isopropanol. Complexes 4 and 6 having a methoxy group attached to the ortho-position of the phenylazo moiety and 2 with a methyl group in the meta-position of the phenolic moiety show high percentage conversion (>84%).

Substitution-Modulated Anticancer Activity of Half-Sandwich Ruthenium(II) Complexes with Heterocyclic Ancillary Ligands

Ten new organometallic half-sandwich ruthenium complexes with heterocyclic ligands have been synthesized (H1-H10). The substituents on the ancillary heterocyclic ligands were varied to understand the effect of substitution on anticancer activity. The crystallographic characterization of five complexes confirms that they adopt three-legged piano-stool structures and are stabilized by intramolecular hydrogen bonding. Complexes H2 and H3 also exhibit halogen bonding in the solid state. In aqueous media, the complexes form dinuclear ruthenium species. Complex H1 with a noncytotoxic heterocycle, 6-fluoro-2-mercaptobenzothiazole, and complex H11 with the unsubstituted 2-mercaptobenzothiazole are the most active against A2780 and KB cell lines. The substitution of the H atoms on the ancillary ligand with Cl or Br atoms leads to a decrease in the anticancer activity. With the exception of fluorine-substituted H5, the complexes with mercaptobenzoxazole (H6-H9) are inactive against all of the tested cell lines. Ruthenium complexes with mercaptonaphthimidazole (H10) and mercaptobenzimidazole (H13) do not show any anticancer activity. The active complexes show a biphasic melting curve when incubated with calf thymus (CT) DNA. These complexes only inhibit thioredoxin reductase (TrxR) enzyme activity to a small extent. The substitution of hydrogen atoms with fluorine atoms in the aromatic heterocyclic ligands on organometallic half-sandwich ruthenium complexes has the most beneficial effect on their anticancer activity.

Synthesis, characterization and reactivity studies of electrophilic ruthenium(II) complexes: a study of H-2 activation and labilization

Reaction of 2,2'-bipyridine (bpy) with dinuclear complexesRuCl(dfppe)(mu-Cl)(3)Ru(dmso-S)(3)](dfppe = 1,2-bis(dipentafluorophenyl phosphino)ethane (C6F5)(2)PCH2CH2P(C6F5)(2); dmso = dimethyl sulfoxide) (1) or RuCl(dfppe)(mu-Cl)(3)RuCl(dfppe)] (2) affords the mononuclear species trans-RuCl2(bpy)(dfppe)] (3). Using this precursor complex (3), a series of new cationic Ru(II) electrophilic complexes RuCl(L)(bpy)(dfppe)]Z] (L = P(OMe)(3) (5), PMe3 (6), CH3CN (7), CO (8), H2O (9); Z = OTf (5, 6, 7, 8), BAr4F (9) have been synthesized via abstraction of chloride by AgOTf or NaBAr4F in the presence of L. Complexes 5 and 6 were converted into the corresponding isomeric hydride derivatives RuH(PMe3)(bpy)(dfppe)]OTf] (10a, 10b) and RuH(P(OMe)(3))(bpy)(dfppe)]OTf] (11a, 11b) respectively, when treated with NaBH4. Protonation of the cationic monohydride complex (11a) with HOTf at low temperatures resulted in H-2 evolution accompanied by the formation of either solvent or triflate bound six coordinated species Ru(S)(P(OMe)(3))(bpy)(dfppe)]OTf](n) (S = solvent (n = 2), triflate (n = 1)] (13a/13b); these species have not been isolated and could not be established with certainty. They (13a/13b) were not isolated, instead the six-coordinated isomeric aqua complexes cis-(Ru(bpy)(dfppe)(OH2)(P(OMe)(3))]OTf](2) (14a/14b) were isolated. Reaction of the aqua complexes (14a/14b) with 1 atm of H-2 at room temperature in acetone-d(6) solvent resulted in heterolytic cleavage of the H-H bond. Results of the studies on H-2 lability and heterolytic activation using these complexes are discussed. The complexes 3, 5, 11a, and 14a have been structurally characterized.

Oligoaniline-Functionalized terpyridine ligands and their ruthenium(II) complexes: synthesis, spectroscopic property and redox behaviors

A series of oligoaniline-functionalized mono- and bis-topic terpyridine ligands, i.e. C6H5[N(R)C6H4](n)TPY (R = H, butyl, tert-butyloxycarbonyl; n = 1-4; TPY = 2,2':6',2"-terpyridyl) and TPYC6H4[N(R)C6H4](m)TPY (R = H, tert-butyloxycarbonyl; m = 2, 4), and the corresponding monoand bis-nuclear ruthenium(II) complexes have been synthesized and verified. The spectroscopic results indicate that two kinds of pi-pi* transitions from TPY and oligoaniline fragments of ligands strongly shift to lower energy, and the metal-to-ligand charge-transfer transition ((MLCT)-M-1) bands of all obtained complexes are considerably red-shifted (Delta lambda(max) = 22-64 nm) and their intensities become much more intense (approximately 4-6 times), compared with those of the reported complex [Ru(TPY)(2)](2+). Moreover, the spectroscopic properties of the ligands and complexes with longer oligoaniline units (n = 3, 4) are markedly influenced by the external stimulus, such as the oxidation and proton acid doping.

Highly efficient electrochemiluminescence of functionalized tris(2,2 '-bipyridyl)ruthenium(II) enrichment of its co-reactants

An enhanced electrochemiluminescence (ECL) efficiency is obtained from the ruthenium complex tris(2,2'-bipyridyl)ruthenium(II) (Ru(bpy)(3)(2+)) by introduction of an ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate (BMImBF(4)). Upon addition of 1% (v/v) BMImBF(4) to 0.1 mm Ru(bpy)(3)(2+) solution, a maximum increase in ECL intensity is obtained both at an indium tin oxide (ITO) electrode (15-fold) and at a glassy carbon (GC) electrode (5- to 64old). Furthermore, upon addition of 1% (v/v) BMImBF4 to 5 pm Ru(bpy)(3)(2+)/100 mm co-reactant systems at a GC electrode, IL adsorption occurs at the electrode surface, which results in a change of the polarity of the electrode surface. Such functionalization greatly improves the functions of both Ru(bpy)(3)(2+) and ionic liquids, as is demonstrated in the sensitive and selective concentration enrichment of the Ru(bpy)(3)(2+) co-reactants.

Tris(2,2 '-bipyridyl) ruthenium(II) doped silica film modified indium tin oxide electrode and its electrochemiluminescent properties

An approach was reported to synthesize silica hybridized ruthenium bipyridyl complex through amidation reaction by covalent attachment of bis(bipyridyl)-4,4'-dicarboxy-2,2'-bipyridyl-ruthenium to (3-aminopropyl)-triethoxysilane. The hybrid complex then was gelatinized through acid catalytic hydrolysis method and a sol-gel modified indium, tin oxide electrode was prepared via spin coating technique. As prepared indium tin oxide electrode possesses good stability therein with excellent electrochemiluminescence behavior.

Charge carrier transporting, photoluminescent, and electroluminescent properties of zinc(II)-2-(2-hydroxyphenyl)benzothiazolate complex

Zinc(II)-2-(2-hydroxyphenyl)benzothiazolate complex is an excellent white-light-emitting material. Despite some studies devoted to this complex, no information on the real origin of the unusually broad electroluminescent (EL) emission is available. Therefore, we investigate photoluminescent and EL properties of the zinc complex. Orange phosphorescent emission at 580 nm was observed for the complex in thin film at 77 K, whereas only fluorescent emission was obtained at room temperature. Molecular orbitals, excitation energy, and emission energy of the complex were investigated using quantum chemical calculations. We fabricated the device with a structure of ITO/F16CuPc(5.5 nm)/Zn-complex/Al, where F16CuPc is hexadecafluoro copper phthalocyanine. The EL spectra varied strongly with the thickness of the emissive layer. We observed a significant change in the emission spectra with the viewing angles. Optical interference effects and light emission originating both from fluorescence and from phosphorescence can explain all of the observed phenomena, resulting in the broad light emission for the devices based on the Zn complex. We calculated the charge transfer integral and the reorganization energy to explain why the Zn complex is a better electron transporter than a hole transporter.

Synthesis, 2D NMR, electrochemistry and luminescence of ruthenium(II) complexes with 2,2 '-bipyridine and 5-(omega-bromoalkylamido)-1,10-phenanthroline

The efficient synthesis of 5-(5-bromovaleramido)-1,10-phenanthroline, 5-(6-bromohexanamido)-1,10-phenanthroline, and 5-(11-bromoundecanamido)-1,10-phenanthroline are described, which reacted with cis-Ru(bpy)(2)Cl-2. 2H(2)O and sodium hexafluorophosphate to form Ru(bpy)(2)[phen-NHCO(CH2)(n)Br](PF6)(2) (n = 4, 5 or 10; phen = 1,10-phenanthroline). The intricate H-1 NMR spectra at low field of these complexes were completely assigned in virtue of H-1-H-1 COSY technique. Cyclic voltammetry was used to study electrochemical behaviours of these complexes, and their luminescent properties were investigated with fluorescent spectra.

Synthesis, electrochemistry, and photophysics of a novel binuclear polypyridyl Ru ( II ) complex with an 1,8-adipoylamido-bis(1, 10-phenanthroline-5-yl) ligand

The present paper covers the syntheses of 1,8-adipoylamido-bis(1,10-phenanthroline-5-yl)(bphaa) and its binuclear complex {[(bpy)(2)Ru](2)(bphaa)} (PF6)(4), where bpy is 2,2'-bipyridine. The two novel compounds were confirmed by means of elemental analysis, IR, and LD-MS and H-1 NMR, and H-1 NMR spectra were completely assigned in virtue of H-1-H-1 COSY. chemical behavior of the binuclear Ru (I) complex was obtained using cyclic and voltammetry. Its photophysical property was investigated by electronic absorption, excitation and emission spectra.

Synthesis and crystal structure of a novel compound constructed from tris-(2, 2 '-bipy)ruthenium(II) and decatungstate

Self-assembly of tris-[2,2 ' -bipyridine]ruthenium(II) chloride with decatunstate produced a novel cation radical salt, [Ru(bpy)(3)](2)[W10O32] . 3DMSO. This is the first product of 2,2 ' -bipyridineruthenium(II)-polyoxometalates species. Crystal data: Monoclinic, P2(1)/c, a = 12.902(3) Angstrom, b = 21.487(3) Angstrom, c = 15.854(5) Angstrom, beta = 93.46(2)degrees, V = 4387(2) Angstrom (3), Z = 2, R-1 = 0.0599, wR2 = 0.1183. X-ray crystallographic study showed that the crystal structure was constructed by electyrostatic attraction and C-H . . .O hydrogen bonds between tris-[2,2 ' -bipyridine]ruthenium(II) and decatungstate polyanion. The tris-[2,2 ' -bipyridine]ruthenium molecules occupy cavities in the polyoxometalate lattice ordered along b-axis. (C) 2001 Elsevier Science B.V. All rights reserved.

A new bifunctional para-toluenesulfonamidophenanthroline-aminoquinoline ligand. Synthesis and characterisation of the corresponding Ru(II) complex

The synthesis and characterisation of a new bifunctional Ru(II) complex are presented. This compound contains a metallic unit, photo-reactive versus the guanines of DNA, and a new bifunctional ligand. An intramolecular luminescence quenching makes this complex an attractive candidate for photoprobing DNA where the intramolecular quenching process is inhibited with restoration of luminescence. © 1998 Elsevier Science S.A. All rights reserved.

The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.