940 resultados para PCR amplification
Resumo:
In this paper, we report a coupling of fluorophore-DNA barcode and bead-based
immunoassay for the detection of Avian Influenza Virus (AIV), a potential pandemic threat for human health and enormous economic losses. The detection strategy is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representatively fluorescent barcodes. Despite its simplicity the assay has sensitivity comparable to RT-PCR amplification, and possesses a great potential as a rapid and sensitive on-chip detection format.
Resumo:
The ability to rapidly detect circulating small RNAs, in particular microRNAs (miRNAs), would further increase their already established potential as biomarkers in a range of conditions. One rate-limiting factor is the time taken to perform quantitative real time PCR amplification. We therefore evaluated the ability of a novel thermal cycler to perform this step in less than 10 minutes. Quantitative PCR was performed on an xxpress® thermal cycler (BJS Biotechnologies, Perivale, UK), which employs a resistive heating system and forced air cooling to achieve thermal ramp rates of 10 °C/s, and a conventional peltier-controlled LightCycler 480 system (Roche, Basel, Switzerland) ramping at 4.8 °C/s. The threshold cycle (Ct) for detection of 18S rDNA from a standard genomic DNA sample was significantly more variable across the block (F-test, p=2.4x10-25) for the xxpress (20.01±0.47SD) than the LightCycler (19.87±0.04SD). RNA was extracted from human plasma, reverse transcribed and a panel of miRNAs amplified and detected using SYBR green (Kapa Biosystems, Wilmington, Ma, USA). The sensitivity of both systems was broadly comparable and both detected a panel of miRNAs reliably and indicated similar relative abundances. The xxpress thermal cycler facilitates rapid qPCR detection of small RNAs and brings point-of care diagnostics based upon circulating miRNAs a step closer to reality.
Resumo:
The distribution of sulphate-reducing bacteria (SRB) in the sediments of the Colne River estuary, Essex, UK covering different saline concentrations of sediment porewater was investigated by the use of quantitative competitive PCR. Here, we show that a new PCR primer set and a new quantitative method using PCR are useful tools for the detection and the enumeration of SRB in natural environments. A PCR primer set selective for the dissimilatory sulphite reductase gene (dsr) of SRB was designed. PCR amplification using the single set of dsr-specific primers resulted in PCR products of the expected size from all 27 SRB strains tested, including Gram-negative and positive species. Sixty clones derived from sediment DNA using the primers were sequenced and all were closely related with the predicted dsr of SRB. These results indicate that PCR using the newly designed primer set are useful for the selective detection of SRB from a natural sample. This primer set was used to estimate cell numbers by dsr selective competitive PCR using a competitor, which was about 20% shorter than the targeted region of dsr. This procedure was applied to sediment samples from the River Colne estuary, Essex, UK together with simultaneous measurement of in situ rates of sulphate reduction. High densities of SRB ranging from 0.2 - 5.7 × 108 cells ml-1 wet sediment were estimated by the competitive PCR assuming that all SRB have a single copy of dsr. Using these estimates cell specific sulphate reduction rates of 10-17 to 10-15 mol of SO42- cell-1 day-1 were calculated, which is within the range of, or lower than, those previously reported for pure cultures of SRB. Our results show that the newly developed competitive PCR technique targeted to dsr is a powerful tool for rapid and reproducible estimation of SRB numbers in situ and is superior to the use of culture-dependent techniques.
Resumo:
Identification of Fusarium species has always been difficult due to confusing phenotypic classification systems. We have developed a fluorescent-based polymerase chain reaction assay that allows for rapid and reliable identification of five toxigenic and pathogenic Fusarium species. The species includes Fusarium avenaceum, F. culmorum, F. equiseti, F. oxysporum and F. sambucinum. The method is based on the PCR amplification of species-specific DNA fragments using fluorescent oligonucleotide primers, which were designed based on sequence divergence within the internal transcribed spacer region of nuclear ribosomal DNA. Besides providing an accurate, reliable, and quick diagnosis of these Fusaria, another advantage with this method is that it reduces the potential for exposure to carcinogenic chemicals as it substitutes the use of fluorescent dyes in place of ethidium, bromide. Apart from its multidisciplinary importance and usefulness, it also obviates the need for gel electrophoresis. (C) 2002 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.
Resumo:
Introduction: Several reasons may lead to the failure of polymerase chain reaction (PCR) using DNA purified from paraffin-embedded materials: presence of inhibitors and degradation of target DNA. DNA dilution will often reduce the concentration of potential inhibitors and still contain enough DNA to allow PCR amplification. Objective: To evaluate the dilution influence of DNA purified from paraffin-embedded materials on β-globin PCR amplification. Material and Method: Paraffin-embedded blocks from 30 patients with oropharynx squamous cell carcinomas, diagnosed and treated at the Oral Oncology Center were selected. DNA extraction was performed using QIAmp minikit (Quiagen). DNA was quantified and evaluated for purity by spectrophotometer analysis. Two groups were formed with different amounts of DNA: group I had the originally extracted DNA and group II had the same DNA, however diluted with ultrapure water addition. PCR was performed in both groups using oligonucleotides for human β-globin gene. Results: For Group I, amplification of the β-globin gene sequence was successful in 33.33% of the samples and for Group II, in 23.33%. Conclusion: Dilution of the DNA extracted of paraffin-embedded materials did not modify statistically the amount of positive samples β-globin gene amplified in PCR, although the results suggest that this is a way to increase the method for efficacy amplification of PCR.
Resumo:
Cryptosporidium parvum infection is very important with respect to public health, owing to foodborne and waterborne outbreaks and gastrointestinal illness in immunocompetent and immunocompromised persons. In cattle, infection with this species manifests either as a subclinical disease or with diarrheal illness, which occurs more often in the presence of other infectious agents than when alone. The aim of this study was to develop a real-time polymerase chain reaction (PCR) assay for the detection of C. parvum in calf fecal samples and to compare the results of this assay with those of the method routinely used for the diagnosis of Cryptosporidium spp., nested PCR targeting the 18S rRNA gene. Two hundred and nine fecal samples from calves ranging in age from 1 day to 6 months were examined using real-time PCR specific for the actin gene of C. parvum and by a nested PCR targeting the 18S rRNA gene of Cryptosporidium spp. Using real-time PCR detection, 73.2% (153 out of 209) of the samples were positive for C. parvum, while 56.5% (118 out of 209) of the samples were positive for Cryptosporidium spp. when the nested PCR amplification method was used for the detection. The analytical sensitivity of the real-time PCR was approximately one C. parvum oocyst. There was no significant nonspecific DNA amplification of any of the following species and genotype: Cryptosporidium andersoni, Cryptosporidium baileyi, Cryptosporidium bovis, Cryptosporidium canis, Cryptosporidium galli, Cryptosporidium ryanae, Cryptosporidium serpentis, or avian genotype II. Thus, we conclude that real-time PCR targeting the actin gene is a sensitive and specific method for the detection of C. parvum in calf fecal samples.
Resumo:
This study evaluated the applicability of kDNA-PCR as a prospective routine diagnosis method for American tegumentary leishmaniasis (ATL) in patients from the Instituto de Infectologia Emílio Ribas (IIER), a reference center for infectious diseases in São Paulo - SP, Brazil. The kDNA-PCR method detected Leishmania DNA in 87.5% (112/128) of the clinically suspected ATL patients, while the traditional methods demonstrated the following percentages of positivity: 62.8% (49/78) for the Montenegro skin test, 61.8% (47/76) for direct investigation, and 19.3% (22/114) for in vitro culture. The molecular method was able to confirm the disease in samples considered negative or inconclusive by traditional laboratory methods, contributing to the final clinical diagnosis and therapy of ATL in this hospital. Thus, we strongly recommend the inclusion of kDNA-PCR amplification as an alternative diagnostic method for ATL, suggesting a new algorithm routine to be followed to help the diagnosis and treatment of ATL in IIER.
Resumo:
BACKGROUND: Culture-independent methods based on the 16S ribosomal RNA molecule are nowadays widely used for assessment of the composition of the intestinal microbiota, in relation to host health or probiotic efficacy. Because Bifidobacterium thermophilum was only recently isolated from human faeces until now, no specific real-time PCR (qPCR) assay has been developed for detection of this species as component of the bifidobacterial community of the human intestinal flora. RESULTS: Design of specific primers and probe was achieved based on comparison of 108 published bifidobacterial 16S rDNA sequences with the recently published sequence of the human faecal isolate B. thermophilum RBL67. Specificity of the primer was tested in silico by similarity search against the sequence database and confirmed experimentally by PCR amplification on 17 Bifidobacterium strains, representing 12 different species, and two Lactobacillus strains. The qPCR assay developed was linear for B. thermophilum RBL67 DNA quantities ranging from 0.02 ng/microl to 200 ng/microl and showed a detection limit of 10(5) cells per gram faeces. The application of this new qPCR assay allowed to detect the presence of B. thermophilum in one sample from a 6-month old breast-fed baby among 17 human faecal samples tested. Additionally, the specific qPCR primers in combination with selective plating experiments led to the isolation of F9K9, a faecal isolate from a 4-month old breast-fed baby. The 16S rDNA sequence of this isolate is 99.93% similar to that of B. thermophilum RBL67 and confirmed the applicability of the new qPCR assay in faecal samples. CONCLUSION: A new B. thermophilum-specific qPCR assay was developed based on species-specific target nucleotides in the 16S rDNA. It can be used to further characterize the composition of the bifidobacterial community in the human gastrointestinal tract. Until recently, B. thermophilum was considered as a species of animal origin, but here we confirm with the application of this new PCR assay the presence of B. thermophilum strains in the human gut.
Resumo:
An identification system for Clostridium chauvoei, using PCR amplification of the 16S rRNA gene (rrs) with specific oligonucleotide primers and subsequent restriction digestion of the amplification product is described. The specific oligonucleotide primers were designed based on the rrs gene sequences of C. chauvoei by comparing it to the DNA sequences of the rrs genes of its most closely related species Clostridium septicum and Clostridium carnis. A subsequent restriction digestion of the 960 bp amplification product was used in order to unambiguously identify C. chauvoei. The developed identification system was evaluated on clinical material during a recent outbreak of blackleg in cattle. Thereby, C. chauvoei was identified as the etiologic agent of the outbreak either directly from clinical samples of muscle, liver, spleen and kidney or from primary cultures made with this material. A comparison of the newly developed method with standard diagnostic tools for C. chauvoei showed that it has advantages over the immunofluorescence and is, therefore, a useful option to it. Moreover, the assay is a valuable tool for the phylogenetic identification of C. chauvoei which can assist to substitute the fastidious traditional identification methods and replace laboratory animal testing currently used.
Resumo:
A rapid and simple DNA labeling system has been developed for disposable microarrays and has been validated for the detection of 117 antibiotic resistance genes abundant in Gram-positive bacteria. The DNA was fragmented and amplified using phi-29 polymerase and random primers with linkers. Labeling and further amplification were then performed by classic PCR amplification using biotinylated primers specific for the linkers. The microarray developed by Perreten et al. (Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J.Clin.Microbiol. 43, 2291-2302.) was improved by additional oligonucleotides. A total of 244 oligonucleotides (26 to 37 nucleotide length and with similar melting temperatures) were spotted on the microarray, including genes conferring resistance to clinically important antibiotic classes like β-lactams, macrolides, aminoglycosides, glycopeptides and tetracyclines. Each antibiotic resistance gene is represented by at least 2 oligonucleotides designed from consensus sequences of gene families. The specificity of the oligonucleotides and the quality of the amplification and labeling were verified by analysis of a collection of 65 strains belonging to 24 species. Association between genotype and phenotype was verified for 6 antibiotics using 77 Staphylococcus strains belonging to different species and revealed 95% test specificity and a 93% predictive value of a positive test. The DNA labeling and amplification is independent of the species and of the target genes and could be used for different types of microarrays. This system has also the advantage to detect several genes within one bacterium at once, like in Staphylococcus aureus strain BM3318, in which up to 15 genes were detected. This new microarray-based detection system offers a large potential for applications in clinical diagnostic, basic research, food safety and surveillance programs for antimicrobial resistance.
Resumo:
Genes that are characteristic of only certain strains of a bacterial species can be of great biologic interest. Here we describe a PCR-based subtractive hybridization method for efficiently detecting such DNAs and apply it to the gastric pathogen Helicobacter pylori. Eighteen DNAs specific to a monkey-colonizing strain (J166) were obtained by subtractive hybridization against an unrelated strain whose genome has been fully sequenced (26695). Seven J166-specific clones had no DNA sequence match to the 26695 genome, and 11 other clones were mixed, with adjacent patches that did and did not match any sequences in 26695. At the protein level, seven clones had homology to putative DNA restriction-modification enzymes, and two had homology to putative metabolic enzymes. Nine others had no database match with proteins of assigned function. PCR tests of 13 unrelated H. pylori strains by using primers specific for 12 subtracted clones and complementary Southern blot hybridizations indicated that these DNAs are highly polymorphic in the H. pylori population, with each strain yielding a different pattern of gene-specific PCR amplification. The search for polymorphic DNAs, as described here, should help identify previously unknown virulence genes in pathogens and provide new insights into microbial genetic diversity and evolution.