Proteomics fingerprinting of phagosome maturation and evidence for the role of a Galpha during uptake.

Phagocytosis, whether of food particles in protozoa or bacteria and cell remnants in the metazoan immune system, is a conserved process. The particles are taken up into phagosomes, which then undergo complex remodeling of their components, called maturation. By using two-dimensional gel electrophoresis and mass spectrometry combined with genomic data, we identified 179 phagosomal proteins in the amoeba Dictyostelium, including components of signal transduction, membrane traffic, and the cytoskeleton. By carrying out this proteomics analysis over the course of maturation, we obtained time profiles for 1,388 spots and thus generated a dynamic record of phagosomal protein composition. Clustering of the time profiles revealed five clusters and 24 functional groups that were mapped onto a flow chart of maturation. Two heterotrimeric G protein subunits, Galpha4 and Gbeta, appeared at the earliest times. We showed that mutations in the genes encoding these two proteins produce a phagocytic uptake defect in Dictyostelium. This analysis of phagosome protein dynamics provides a reference point for future genetic and functional investigations.

IS6110 fingerprinting of sensitive and resistant strains (1991-1992) of Mycobacterium tuberculosis in Colombia

The standardized method to study the polymorphism of IS 6110 was used to characterize 53 isolates of Mycobacterium tuberculosis obtained during 1991-1992 from 14 regions in Colombia. In Valle region cluster rate was 25% (4/16). The mean number of IS6110 band was 10 ± 3. Similarity between strains was of 60% in 81% of strains and this tended to be correlated with geographic origin. For the first time M. tuberculosis without IS6110 bands in restriction fragment length polymorphism analysis was found in Colombia. Additional studies are necessaries in order to best characterize the situation in relation to human immunodeficiency virus epidemic and recent changes in tuberculosis control program.

Genetic relationships between sympatric populations of Bacillus cereus and Bacillus thuringiensis, as revealed by rep-PCR genomic fingerprinting

The bacterial strain Bacillus cereus is closely related to Bacillus thuringiensis, although any genetic relationship between the two strains is still in debate. Using rep-PCR genomic fingerprinting, we established the genetic relationships between Brazilian sympatric populations of B. cereus and B. thuringiensis simultaneously collected from two geographically separate sites. We observed the formation of both B. thuringiensis and B. cereus clusters, as well as strains of B. cereus that are more closely related to B. thuringiensis than to other B. cereus strains. In addition, lower genetic variability was observed among B. thuringiensis clusters compared to B. cereus clusters, indicating that either the two species should be categorized as separate or that B. thuringiensis may represent a clone from a B. cereus background.

DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

Typing Candida albicans oral isolates from human immunodeficiency virus-infected patients by multilocus enzyme electrophoresis and DNA fingerprinting.

A total of 189 Candida albicans isolates have been typed by multilocus enzyme electrophoresis. The results obtained confirm the clonal mode of reproduction of C. albicans. The C. albicans populations found in the oropharynx of human immunodeficiency virus (HIV)-infected patients, in the oropharynx of healthy carriers, or in association with invasive candidiasis could not be distinguished. No clone or group of clones could be associated with the appearance of clinical disorders or with a reduced in vitro susceptibility to the antifungal agent fluconazole. Multiple and sequential oral isolates from 24 HIV-infected patients were also typed by restriction enzyme analysis with the enzymes EcoRI and HinfI and by use of the Ca3 repetitive probe. The results obtained by the combination of all three typing methods show that all but one patient each carried a unique major C. albicans clone in their oropharynx. The 21 patients with sequential isolates had the same C. albicans clones in their throats during recurrent oropharyngeal candidiasis episodes, independently of clinical status or of changes of in vitro susceptibility to fluconazole. Finally, several isolates of the same C. albicans clone found simultaneously in the oropharynx of a patient may present different levels of susceptibility to fluconazole.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Detection of metabolite induction in fungal co-cultures on solid media by high-throughput differential ultra-high pressure liquid chromatography-time-of-flight mass spectrometry fingerprinting.

Access to new biological sources is a key element of natural product research. A particularly large number of biologically active molecules have been found to originate from microorganisms. Very recently, the use of fungal co-culture to activate the silent genes involved in metabolite biosynthesis was found to be a successful method for the induction of new compounds. However, the detection and identification of the induced metabolites in the confrontation zone where fungi interact remain very challenging. To tackle this issue, a high-throughput UHPLC-TOF-MS-based metabolomic approach has been developed for the screening of fungal co-cultures in solid media at the petri dish level. The metabolites that were overexpressed because of fungal interactions were highlighted by comparing the LC-MS data obtained from the co-cultures and their corresponding mono-cultures. This comparison was achieved by subjecting automatically generated peak lists to statistical treatments. This strategy has been applied to more than 600 co-culture experiments that mainly involved fungal strains from the Fusarium genera, although experiments were also completed with a selection of several other filamentous fungi. This strategy was found to provide satisfactory repeatability and was used to detect the biomarkers of fungal induction in a large panel of filamentous fungi. This study demonstrates that co-culture results in consistent induction of potentially new metabolites.

Classification and fingerprinting of different berries based on biochemical profiling and antioxidant capacity

The objective of this work was to evaluate the biochemical composition of six berry types belonging to Fragaria, Rubus, Vaccinium and Ribes genus. Fruit samples were collected in triplicate (50 fruit each) from 18 different species or cultivars of the mentioned genera, during three years (2008 to 2010). Content of individual sugars, organic acids, flavonols, and phenolic acids were determined by high performance liquid chromatography (HPLC) analysis, while total phenolics (TPC) and total antioxidant capacity (TAC), by using spectrophotometry. Principal component analysis (PCA) and hierarchical cluster analysis (CA) were performed to evaluate the differences in fruit biochemical profile. The highest contents of bioactive components were found in Ribes nigrum and in Fragaria vesca, Rubus plicatus, and Vaccinium myrtillus. PCA and CA were able to partially discriminate between berries on the basis of their biochemical composition. Individual and total sugars, myricetin, ellagic acid, TPC and TAC showed the highest impact on biochemical composition of the berry fruits. CA separated blackberry, raspberry, and blueberry as isolate groups, while classification of strawberry, black and red currant in a specific group has not occurred. There is a large variability both between and within the different types of berries. Metabolite fingerprinting of the evaluated berries showed unique biochemical profiles and specific combination of bioactive compound contents.

Fingerprinting automático de contenidos digitales inspirado en las secuencias de ADN

Peer-reviewed

Nutrimetabolomics fingerprinting to identify biomarkers of bread exposure in a free-living population from the PREDIMED study cohort

Bread is one of the most widely consumed foods. Its impact on human health is currently of special interest for researchers. We aimed to identify biomarkers of bread consumption by applying a nutrimetabolomic approach to a free-living population. An untargeted HPLC q-TOF-MS and multivariate analysis was applied to human urine from 155 subjects stratified by habitual bread consumption in three groups: non-consumers of bread (n = 56), white-bread consumers (n = 48) and whole-grain bread consumers (n = 51). The most differential metabolites (variable importance for projection ≥1.5) included compounds originating from cereal plant phytochemicals such as benzoxazinoids and alkylresorcinol metabolites, and compounds produced by gut microbiota (such as enterolactones, hydroxybenzoic and dihydroferulic acid metabolites). Pyrraline, riboflavin, 3-indolecarboxylic acid glucuronide, 2,8-dihydroxyquinoline glucuronide and N-α-acetylcitrulline were also tentatively identified. In order to combine multiple metabolites in a model to predict bread consumption, a stepwise logistic regression analysis was used. Receiver operating curves were constructed to evaluate the global performance of individual metabolites and their combination. The area under the curve values [AUC (95 % CI)] of combined models ranged from 77.8 % (69.1 86.4 %) to 93.7 % (89.4 98.1 %), whereas the AUC for the metabolites included in the models had weak values when they were evaluated individually: from 58.1 % (46.6 69.7 %) to 78.4 % (69.8 87.1 %). Our study showed that a daily bread intake significantly impacted on the urinary metabolome, despite being examined under uncontrolled free-living conditions. We further concluded that a combination of several biomarkers of exposure is better than a single biomarker for the predictive ability of discriminative analysis.

Nutrimetabolomics fingerprinting to identify biomarkers of bread exposure in a free-living population from the PREDIMED study cohort

Bread is one of the most widely consumed foods. Its impact on human health is currently of special interest for researchers. We aimed to identify biomarkers of bread consumption by applying a nutrimetabolomic approach to a free-living population. An untargeted HPLC q-TOF-MS and multivariate analysis was applied to human urine from 155 subjects stratified by habitual bread consumption in three groups: non-consumers of bread (n = 56), white-bread consumers (n = 48) and whole-grain bread consumers (n = 51). The most differential metabolites (variable importance for projection ≥1.5) included compounds originating from cereal plant phytochemicals such as benzoxazinoids and alkylresorcinol metabolites, and compounds produced by gut microbiota (such as enterolactones, hydroxybenzoic and dihydroferulic acid metabolites). Pyrraline, riboflavin, 3-indolecarboxylic acid glucuronide, 2,8-dihydroxyquinoline glucuronide and N-α-acetylcitrulline were also tentatively identified. In order to combine multiple metabolites in a model to predict bread consumption, a stepwise logistic regression analysis was used. Receiver operating curves were constructed to evaluate the global performance of individual metabolites and their combination. The area under the curve values [AUC (95 % CI)] of combined models ranged from 77.8 % (69.1 86.4 %) to 93.7 % (89.4 98.1 %), whereas the AUC for the metabolites included in the models had weak values when they were evaluated individually: from 58.1 % (46.6 69.7 %) to 78.4 % (69.8 87.1 %). Our study showed that a daily bread intake significantly impacted on the urinary metabolome, despite being examined under uncontrolled free-living conditions. We further concluded that a combination of several biomarkers of exposure is better than a single biomarker for the predictive ability of discriminative analysis.

Molecular characterization of Brazilian strains of Xanthomonas campestris pv. viticola by rep-PCR fingerprinting

Bacterial canker of grapevine (Vitis vinifera), caused by Xanthomonas campestris pv. viticola was first detected in Brazil in 1998, affecting grapevines in the São Francisco river basin, state of Pernambuco. The disease was also reported in Juazeiro, Bahia and later in Piauí and Ceará. Due to its limited geographical distribution and relatively recent detection in Brazil, very little is known about the pathogen's biology and diversity. Repetitive DNA based-PCR (rep-PCR) profiles were generated from purified bacterial DNA of 40 field strains of X. campestris pv. viticola, collected between 1998 and 2001 in the states of Pernambuco, Bahia and Piauí. Combined analysis of the PCR patterns obtained with primers REP, ERIC and BOX, showed a high degree of similarity among Brazilian strains and the Indian type strain NCPPB 2475. Similar genomic patterns with several diagnostic bands, present in all strains, could be detected. Fingerprints were distinct from those of strains representing other pathovars and from a yellow non-pathogenic isolate from grape leaves. The polymorphism observed among the Brazilian strains allowed their separation into five subgroups, although with no correlation with cultivar of origin, geographic location or year collected.

Synecological comparisons sustained by ecophysiological fingerprinting of intrinsic photosynthetic capacity of plants as assessed by measurements of light response curves

In some literature variations in photosynthetic rates are considered to be of little relevance for individual fitness. This depends among other things on how one defines fitness, i.e. if one takes strictly Darwinian fitness as seed production or if one needs to evaluate particular traits and consider plant establishment. It also matters if one takes the Darwinian "organism individual" as the central entity in evolution ("individual fitness") or the "species individual" in a modified "Structure of Evolutionary Theory" sensu Stephen Jay Gould. A phenotypically expressed trait like photosynthetic rate, even if intra- and interspecific differences may be small, can matter in habitat performance and niche acquisition. Light dependence curves (LCs) of photosynthetic rates are now readily measured under field conditions using miniaturized equipment of pulse amplitude modulated fluorometers. In contrast to actual momentary measurements of quantum yield of photosynthesis under actually prevailing ambient conditions, LC measurements reflect the expressed intrinsic capacity of photosynthesis. In this review we explore the power of LC measurements yielding cardinal points such as maximum apparent electron transport rate of photosystem II (ETRmax) and saturating photosynthetically active radiation (PARsat) in making intra- and interspecific comparisons of plant performance and synecological fingerprinting in ecophysiological studies across species, sites, habitats and ecosystems.

DNA fingerprinting of Mycobacterium tuberculosis from patients with and without AIDS in Rio de Janeiro

Isolates of Mycobacterium tuberculosis derived from patients with AIDS from a single hospital in Rio de Janeiro were typed using a standardized RFLP technique detecting IS6110 polymorphism. Nineteen isolates were obtained from 15 different patients. Eleven distinct IS6110 patterns were found, with 4 banding patterns shared by 2 patients. The clustering value of 53% was much higher in comparison with clustering of M. tuberculosis strains from TB patients without clinical signs for HIV infection from randomly selected health centers. We present these results as preliminary data on M. tuberculosis strain polymorphism in Brazil and on the higher risk for recent transmission amongst patients with AIDS