978 resultados para Negative regulation
Resumo:
Preeclampsia is characterized clinically by hypertension and proteinuria. Soluble Flt-1 (sFlt-1; also known as soluble vascular endothelial growth factor receptor-1 [VEGFR-1]) and soluble endoglin (sEng) are elevated in preeclampsia, and their administration to pregnant rats elicits preeclampsia-like symptoms. Heme oxygenase-1 (HO-1) and its metabolite carbon monoxide (CO) exert protective effects against oxidative stimuli. Thus, we hypothesized that HO-1 upregulation may offer protection against preeclampsia by inhibiting sFlt-1 and sEng release.
Negative regulation of the hepatic fibrogenic response by suppressor of cytokine signaling 1 (SOCS1)
Resumo:
Abstract: Suppressor of cytokine signaling 1 (SOCS1) is an indispensable regulator of IFN-γ signaling and has been implicated in the regulation of liver fibrosis. However, it is not known whether SOCS1 mediates its anti-fibrotic functions in the liver directly, or via modulating IFN-γ, which has been implicated in attenuating hepatic fibrosis. Additionally, it is possible that SOCS1 controls liver fibrosis by regulating hepatic stellate cells (HSC), a key player in fibrogenic response. While the activation pathways of HSCs have been well characterized, the regulatory mechanisms are not yet clear. The goals of this study were to dissociate IFN-γ-dependent and SOCS1-mediated regulation of hepatic fibrogenic response, and to elucidate the regulatory functions of SOCS1 in H SC activation. Liver fibrosis was induced in Socs1[superscript -/-]Ifng[superscript -/-] mice with dimethylnitrosamine or carbon tetrachloride. Ifng[superscript -/-] and C57BL/6 mice served as controls. Following fibrogenic treatments, Socs1[superscript -/-]Ifng[superscript -/-] mice showed elevated serum ALT levels and increased liver fibrosis com-pared to mice Ifng[superscript -/-]. The latter group showed higher alanine aminotransferase (ALT) levels and fibrosis than C57BL/6 controls. The livers of Socs1-deficient mice showed bridging fibrosis, which was associated with increased accumulation of myofibroblasts and abundant collagen deposition. Socs1-deficient livers showed increased expression of genes coding for smooth muscle actin, collagen, and enzymes involved in remodeling the extracellular matrix, namely matrix metalloproteinases and tissue inhibitor of metalloproteinases. Primary HSCs from Socs1-deficient mice showed increased proliferation in response to growth factors such as HGF, EGF and PDGF, and the fibrotic livers of Socs1-deficient mice showed increased expression of the Pdgfb gene. Taken together, these data indicate that SOCS1 controls liver fibrosis independently of IFN-γ and that part of this regulation may occur via regulating HSC proliferation and limiting growth factor availability.
Resumo:
The Notch1 gene has an important role in mammalian cell-fate decision and tumorigenesis. Upstream control mechanisms for transcription of this gene are still poorly understood. In a chemical genetics screen for small molecule activators of Notch signalling, we identified epidermal growth factor receptor (EGFR) as a key negative regulator of Notch1 gene expression in primary human keratinocytes, intact epidermis and skin squamous cell carcinomas (SCCs). The underlying mechanism for negative control of the Notch1 gene in human cells, as well as in a mouse model of EGFR-dependent skin carcinogenesis, involves transcriptional suppression of p53 by the EGFR effector c-Jun. Suppression of Notch signalling in cancer cells counteracts the differentiation-inducing effects of EGFR inhibitors while, at the same time, synergizing with these compounds in induction of apoptosis. Thus, our data reveal a key role of EGFR signalling in the negative regulation of Notch1 gene transcription, of potential relevance for combinatory approaches for cancer therapy.
Resumo:
SHP-1 is a Src homology 2 (SH2) domain-containing tyrosine phosphatase that plays an essential role in negative regulation of immune cell activity. We describe here a new model for regulation of SHP-1 involving phosphorylation of its C-terminal Ser(591) by associated protein kinase Calpha. In human platelets, SHP-1 was found to constitutively associate with its substrate Vav1 and, through its SH2 domains, with protein kinase Calpha. Upon activation of either PAR1 or PAR4 thrombin receptors, the association between the three proteins was retained, and Vav1 became phosphorylated on tyrosine and SHP-1 became phosphorylated on Ser(591). Phosphorylation of SHP-1 was mediated by protein kinase C and negatively regulated the activity of SHP-1 as demonstrated by a decrease in the in vitro ability of SHP-1 to dephosphorylate Vav1 on tyrosine. Protein kinase Calpha therefore critically and negatively regulates SHP-1 function, forming part of a mechanism to retain SHP-1 in a basal active state through interaction with its SH2 domains, and phosphorylating its C-terminal Ser(591) upon cellular activation leading to inhibition of SHP-1 activity and an increase in the tyrosine phosphorylation status of its substrates.
Resumo:
STUDY OF REST AS A NEGATIVE REGULATOR OF P16INK4A Monica Gireud, B.S. Thesis Advisor: Vidya Gopalakrishnan, Ph.D. The RE1 Silencing Transcription Factor (REST) is a negative regulator of neuronal differentiation. It is expressed ubiquitously in early embryos, but downregulated in neural progenitors concomitant with onset of neuronal differentiation in these cells. REST has been widely studied as a negative regulator of neuronal differentiation genes. Our recent work identified a novel role for REST in control of cell proliferation. However, the underlying molecular mechanism(s) are not known and is a focus of the current thesis project. Here, we provide evidence that REST signaling controls the expression of the cyclin-dependent kinase inhibitor, p16Ink4a, a negative regulator of the cell cycle and passage through G1. We determined that REST expression in the proliferating granule progenitors of the cerebellum and its lack of expression in the differentiated neurons is reciprocally correlated with that of p16Ink4a. Decline in REST levels in differentiating primary and neural stem cells immortalized with v-myc (NSC-M) granule progenitors in vitro was also associated with upregulation of p16Ink4a expression. Conversely, constitutive human REST transgene expression in NSC-M cells (NSC-MRs) blocked p16Ink4 upregulation, even under neuronal differentiation conditions. However, the lack of a consensus REST DNA binding RE1 element in the regulatory regions of p16Ink4a locus suggested an indirect regulation of p16Ink4a by REST. Based on work from other groups that showed repression of p16Ink4a transcription by the polycomb protein Bmi-1, and its negative regulation by microRNA-203 (miR-203) and our identification of a RE1 element in the downstream regulatory region of miR-203, we asked if the p16Ink4a expression was controlled by REST through a series of negative regulatory events involving miR-203 and Bmi-1. We observed that Bmi1 -expression mirrored that of REST and inversely correlated with that of miR-203 in the postnatal cerebellum and in vitro differentiated granule and NSC-M progenitors. In contrast, forced REST transgene expression in NSC-MR cells abrogated the decrease in Bmi-1 levels and elevation in miR-203 expression. Significant REST binding to the miR-203 RE1 element was also observed in NSC-M cells, indicating that REST had the potential to directly regulate miR-203 expression. In conclusion, our studies suggest a role for REST in control of cell cycle transit in neural progenitors through negative regulation of p16Ink4a. Further validation of these results in REST knockout mice is needed, and is ongoing.
Resumo:
Skeletal muscle differentiation involves sequential events in which proliferating undifferentiated myoblasts withdraw from the cell cycle and fuse to form multinucleated myotubes. The process of fusion is accompanied by the disappearance of proteins associated with cell proliferation and the coordinate induction of a battery of muscle-specific gene products, which includes the muscle isoenzyme of creatine kinase, nicotinic acetylcholine receptor, and contractile proteins such as alpha-actin. The molecular events associated with myogenesis are particularly amenable to experimental analysis because the events which occur in vivo can be recapitulated in vitro using established muscle cell lines. Initiation of myogenic differentiation in vitro can be achieved by removing serum from the culture medium. Myogenesis, therefore, can be considered to be regulated through a repression-type of mechanism by components in serum. The objectives of this project were to identify the components involved in regulation of myogenesis and approach the mechanism(s) whereby these components achieve their regulatory function. Initially, the effects of a series of polypeptide growth factors on myogenesis were examined. Among them TGF$\beta$ and FGF were found to be potent inhibitors of myogenic differentiation which did not affect cell proliferation. The inhibitory effects of these growth factors on differentiation requires their persistent presence in the culture medium. After myoblasts have undergone fusion, they become refractory to the inhibitory effects of TGF$\beta$, FGF, and serum. When fusion is inhibited by the presence of EGTA, a Ca$\sp{2+}$ chelator, muscle-specific genes are expressed reversibly upon removal of inhibitory growth factors. Subsequent exposure of biochemically differentiated cells to serum or TGF$\beta$ leads to down-regulation of muscle-specific genes. Stimulation with serum also leads to reentry of myocytes into the cell cycle, whereas fused myotubes are irreversibly and terminally differentiated. Measurement of levels of TGF$\beta$ receptors reveals that under non-fusing conditions, TGF$\beta$ receptor levels in biochemically differentiated myocytes remained as high as in undifferentiated myoblasts, while during terminal differentiation, TGF$\beta$ receptors decreased at least five-fold. Thus, down-regulation of TGF$\beta$ receptors is coupled to irreversible differentiation, but not reversible differentiation in the absence of fusion. The possible involvement of second messenger systems, such as cAMP and protein kinase C, in the pathway(s) by which TGF$\beta$, FGF, or serum factors transduce their signals from the cell surface to the nucleus was also examined. The results showed that myogenic differentiation is subject to negative regulation through cAMP elevation-dependent and cAMP elevation-independent pathways and that serum mitogens, TGF$\beta$ and FGF inhibit differentiation through a mechanism independent of cAMP-elevation or protein kinase C activation. ^
Resumo:
The mammalian Forkhead Box (Fox) transcription factor (FoxM1) is implicated in tumorgenesis. However, the role and regulation of FoxM1 in gastric cancer remain unknown.^ I examined FoxM1 expression in 86 cases of primary gastric cancer and 57 normal gastric tissue specimens. I found weak expression of FoxM1 protein in normal gastric mucosa, whereas I observed strong staining for FoxM1 in tumor-cell nuclei in various gastric tumors and lymph node metastases. The aberrant FoxM1 expression is associated with VEGF expression and increased angiogenesis in human gastric cancer. A Cox proportional hazards model revealed that FoxM1 expression was an independent prognostic factor in multivariate analysis. Furthermore, overexpression of FoxM1 by gene transfer significantly promoted the growth and metastasis of gastric cancer cells in orthotopic mouse models, whereas knockdown of FoxM1 expression by small interfering RNA did the opposite. Next, I observed that alteration of tumor growth and metastasis by elevated FoxM1 expression was directly correlated with alteration of VEGF expression and angiogenesis. In addition, promotion of gastric tumorigenesis by FoxM1 directly and significantly correlated with transactivation of vascular endothelial growth factor (VEGF) expression and elevation of angiogenesis. ^ To further investigate the underlying mechanisms that result in FoxM1 overexpression in gastric cancer, I investigated FoxM1 and Krüppel-like factor 4 (KLF4) expressions in primary gastric cancer and normal gastric tissue specimens. Concomitance of increased expression of FoxM1 protein and decreased expression of KLF4 protein was evident in human gastric cancer. Enforced KLF4 expression suppressed FoxM1 protein expression. Moreover, a region within the proximal FoxM1 promoter was identified to have KLF4-binding sites. Finally, I found an increased FoxM1 expression in gastric mucosa of villin-Cre -directed tissue specific Klf4-null mice.^ In summary, I offered both clinical and mechanistic evidence that dysregulated expression of FoxM1 play an important role in gastric cancer development and progression, while KLF4 mediates negative regulation of FoxM1 expression and its loss significantly contributes to FoxM1 dysregulation. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
The essential p21-activated kinase (PAK), Shk1, is a critical component of a Ras/Cdc42/PAK complex required for cell viability, normal cell polarity, proper regulation of cytoskeletal dynamics, and sexual differentiation in the fission yeast, Schizosaccharomyces pombe. While cellular functions of PAKs have been described in eukaryotes from yeasts to mammals, the molecular mechanisms of PAK regulation and function are poorly understood. This study has characterized a novel Shk1 inhibitor, Skb15, and, in addition, identified the cell polarity regulator, Tea1, as a potential biological substrate of Shk1 in S. pombe. Skb15 is a highly conserved WD repeat protein that was discovered from a two-hybrid screen for proteins that interact with the catalytic domain of Shk1. Molecular data indicate that Skb15 negatively regulates Shk1 kinase activity in S. pombe cells. A null mutation in the skb15 gene is lethal and results in deregulation of actin polymerization and localization, microtubule biogenesis, and the cytokinetic machinery, as well as a substantial uncoupling of these processes from the cell cycle. Loss of Skb15 function is suppressed by partial loss of Shk1, demonstrating that negative regulation of Shk1 by Skb15 is required for proper execution of cytoskeletal remodeling and cytokinetic functions. A mouse homolog of Skb15 can substitute for its counterpart in fission yeast, demonstrating that Skb15 protein function has been substantially conserved through evolution. ^ Our laboratory has recently demonstrated that Shk1, in addition to regulating actin cytoskeletal organization, is required for proper regulation of microtubule dynamics in S. pombe cells. The Shk1 protein localizes to interphase and mitotic microtubules, the septum-forming region, and cell ends. This pattern of localization overlaps with that of the cell polarity regulator, Tea1, in S. pombe cells. The tea1 gene was identified by Paul Nurse's laboratory from a screen for genes involved in the control of cell morphogenesis in S. pombe. In contrast to wild type S. pombe cells, which are rod shaped, tea1 null cells are often bent and/or branched in shape. The Tea1 protein localizes to the cell ends, like Shk1, and the growing tips of interphase microtubules. Thus, experiments were performed to investigate whether Tea1 interacts with Shk1. The tea1 null mutation strongly suppresses the loss of function of Skb15, an essential inhibitor of Shk1 function. All defects associated with the skb15 mutation, including defects in F-actin organization, septation, spindle elongation, and chromosome segregation, are suppressed by tea1Δ, suggesting that Tea1 may function in these diverse processes. Consistent with a role for Tea1 in cytokinesis, tea1Δ cells have a modest cell separation defect that is greatly exacerbated by a shk1 mutation and, like Shk1, Tea1 localizes to the septation site. Molecular analyses showed that Tea1 phosphorylation is significantly dependent on Shk1 function in vivo and that bacterially expressed Tea1 protein is directly phosphorylated by recombinant Shk1 kinase in vitro. Taken together, these results identify Tea1 as a potential biological substrate of Shk1 in S. pombe. ^ In summary, this study provides new insights into a conserved regulatory mechanism for PAKs, and also begins to uncover the molecular mechanisms by which the Ras/Cdc42/PAK complex regulates the microtubule and actin cytoskeletons and cell growth polarization in fission yeast. ^
Resumo:
The family of p21-activated protein kinases (PAKs) is composed of serine–threonine kinases whose activity is regulated by the small guanosine triphosphatases (GTPases) Rac and Cdc42. In mammalian cells, PAKs have been implicated in the regulation of mitogen-activated protein cascades, cellular morphological and cytoskeletal changes, neurite outgrowth, and cell apoptosis. Although the ability of Cdc42 and Rac GTPases to activate PAK is well established, relatively little is known about the negative regulation of PAK or the identity of PAK cellular targets. Here, we describe the identification and characterization of a human PAK-interacting protein, hPIP1. hPIP1 contains G protein β-like WD repeats and shares sequence homology with the essential fission yeast PAK regulator, Skb15, as well as the essential budding yeast protein, MAK11. Interaction of hPIP1 with PAK1 inhibits the Cdc42/Rac-stimulated kinase activity through the N-terminal regulatory domains of PAK1. Cotransfection of hPIP1 in mammalian cells inhibits PAK-mediated c-Jun N-terminal kinase and nuclear factor κ B signaling pathways. Our results demonstrate that hPIP1 is a negative regulator of PAK and PAK signaling pathways.
Resumo:
Friend of GATA (FOG) proteins regulate GATA factor-activated gene transcription. During vertebrate hematopoiesis, FOG and GATA proteins cooperate to promote erythrocyte and megakaryocyte differentiation. The Drosophila FOG homologue U-shaped (Ush) is expressed similarly in the blood cell anlage during embryogenesis. During hematopoiesis, the acute myeloid leukemia 1 homologue Lozenge and Glial cells missing are required for the production of crystal cells and plasmatocytes, respectively. However, additional factors have been predicted to control crystal cell proliferation. In this report, we show that Ush is expressed in hemocyte precursors and plasmatocytes throughout embryogenesis and larval development, and the GATA factor Serpent is essential for Ush embryonic expression. Furthermore, loss of ush function results in an overproduction of crystal cells, whereas forced expression of Ush reduces this cell population. Murine FOG-1 and FOG-2 also can repress crystal cell production, but a mutant version of FOG-2 lacking a conserved motif that binds the corepressor C-terminal binding protein fails to affect the cell lineage. The GATA factor Pannier (Pnr) is required for eye and heart development in Drosophila. When Ush, FOG-1, FOG-2, or mutant FOG-2 is coexpressed with Pnr during these developmental processes, severe eye and heart phenotypes result, consistent with a conserved negative regulation of Pnr function. These results indicate that the fly and mouse FOG proteins function similarly in three distinct cellular contexts in Drosophila, but may use different mechanisms to regulate genetic events in blood vs. cardial or eye cell lineages.
Resumo:
Liddle syndrome is a mendelian form of hypertension characterized by constitutively elevated renal Na reabsorption that can result from activating mutations in the beta or gamma subunit of the epithelial Na channel. All reported mutations have deleted the last 45-76 normal amino acids from the cytoplasmic C terminus of one of these channel subunits. While these findings implicate these terminal segments in the normal negative regulation of channel activity, they do not identify the amino acid residues that are critical targets for these mutations. Potential targets include the short highly conserved Pro-rich segments present in the C terminus of beta and gamma subunits; these segments are similar to SH3-binding domains that mediate protein-protein interaction. We now report a kindred with Liddle syndrome in which affected patients have a mutation in codon 616 of the beta subunit resulting in substitution of a Leu for one of these highly conserved Pro residues. The functional significance of this mutation is demonstrated both by the finding that this is a de novo mutation appearing concordantly with the appearance of Liddle syndrome in the kindred and also by the marked activation of amiloride-sensitive Na channel activity seen in Xenopus oocytes expressing channels containing this mutant subunit (8.8-fold increase compared with control oocytes expressing normal channel subunits; P = 0.003). These findings demonstrate a de novo missense mutation causing Liddle syndrome and identify a critical channel residue important for the normal regulation of Na reabsorption in humans.
Resumo:
Oral squamous cell carcinoma is the most common type of cancer in the oral cavity, representing more than 90% of all oral cancers. The characterization of altered molecules in oral cancer is essential to understand molecular mechanisms underlying tumor progression as well as to contribute to cancer biomarker and therapeutic target discovery. Proteoglycans are key molecular effectors of cell surface and pericellular microenvironments, performing multiple functions in cancer. Two of the major basement membrane proteoglycans, agrin and perlecan, were investigated in this study regarding their role in oral cancer. Using real time quantitative PCR (qRT-PCR), we showed that agrin and perlecan are highly expressed in oral squamous cell carcinoma. Interestingly, cell lines originated from distinct sites showed different expression of agrin and perlecan. Enzymatically targeting chondroitin sulfate modification by chondroitinase, oral squamous carcinoma cell line had a reduced ability to adhere to extracellular matrix proteins and increased sensibility to cisplatin. Additionally, knockdown of agrin and perlecan promoted a decrease on cell migration and adhesion, and on resistance of cells to cisplatin. Our study showed, for the first time, a negative regulation on oral cancer-associated events by either targeting chondroitin sulfate content or agrin and perlecan levels.
Resumo:
Background: Much is known about how genes regulated by nuclear receptors (NRs) are switched on in the presence of a ligand. However, the molecular mechanism for gene down-regulation by liganded NRs remains a conundrum. The interaction between two zinc-finger transcription factors, Nuclear Receptor and GATA, was described almost a decade ago as a strategy adopted by the cell to up-or down-regulate gene expression. More recently, cell-based assays have shown that the Zn-finger region of GATA2 (GATA2-Zf) has an important role in down-regulation of the thyrotropin gene (TSH beta) by liganded thyroid hormone receptor (TR). Methodology/Principal Findings: In an effort to better understand the mechanism that drives TSH beta down-regulation by a liganded TR and GATA2, we have carried out equilibrium binding assays using fluorescence anisotropy to study the interaction of recombinant TR and GATA2-Zf with regulatory elements present in the TSH beta promoter. Surprisingly, we observed that ligand (T3) weakens TR binding to a negative regulatory element (NRE) present in the TSH beta promoter. We also show that TR may interact with GATA2-Zf in the absence of ligand, but T3 is crucial for increasing the affinity of this complex for different GATA response elements (GATA-REs). Importantly, these results indicate that TR complex formation enhances DNA binding of the TR-GATA2 in a ligand-dependent manner. Conclusions: Our findings extend previous results obtained in vivo, further improving our understanding of how liganded nuclear receptors down-regulate gene transcription, with the cooperative binding of transcription factors to DNA forming the core of this process.
Resumo:
p53 is known to repress transcription of a number of genes, but the mechanism of p53 recruitment to these target genes is unknown. The c-myb proto-oncogene product (c-Myb) positively regulates proliferation of immature hematopoietic cells, whereas p53 blocks cell cycle progression. Here, we demonstrate that p53 inhibits c-Myb-induced transcription and transformation by directly binding to c-Myb. The ability of c-Myb to maintain the undifferentiated state of M1 cells was also suppressed by p53. p53 did not affect the ability of c-Myb to bind to DNA but formed a ternary complex with the corepressor mSin3A and c-Myb. Thus, p53 antagonizes c-Myb by recruiting mSin3A to down-regulate specific Myb target genes.