Cross-amplification of polymorphic microsatellites reveals extra-pair paternity and brood parasitism in Sturnus vulgaris

We tested the cross-amplification of 37 microsatellites in a population of starlings (Stumus vulgaris). Twenty-three of them amplified and five exhibited a large number of alleles per locus and high heterozygosity (on average: 14.6 alleles/locus and H. = 0.704). We assessed the occurrence of extra-pair paternity (EPP) and intraspecific brood parasitism GBP) in this population. The EPP rate was 16% to 18% offspring from 43% to 45% of nests. IBP was very variable between two successive years (14% to 27% chicks from 25% to 64% of clutches). These five polymorphic markers will be of potential use in studies of genetic diversity, population structure and reproductive strategy of this species.

Extra-pair paternity, testes size and testosterone level in relation to colour polymorphism in the barn owl Tyto alba

In many bird populations, individuals display one of several genetically inherited colour morphs. Colour polymorphism can be maintained by several mechanisms one of which being frequency-dependent selection with colour morphs signalling alternative mating strategies. One morph may be dominant and territorial, and another one adopt a sneaky behaviour to gain access to fertile females. We tested this hypothesis in the barn owl Tyto alba in which coloration varies from reddish-brown to white. This trait is heritable and neither sensitive to the environment in which individuals live nor to body condition. In Switzerland, reddish-brown males were observed to feed their brood at a higher rate and to produce more offspring than white males. This observation lead us to hypothesize that white males may equalise fitness by investing more effort in extra-pair copulations. This hypothesis predicts that lighter Coloured males produce more extra-pair young, have larger testes and higher levels of circulating testosterone. However, our results are not consistent with these three predictions. First, paternity analyses of 54 broods with a total of 211 offspring revealed that only one young was not sired by the male that was feeding it. Second, testes size was not correlated with male plumage coloration suggesting that white males are not sexually more active. Finally, in nestlings at the time of feather growth testosterone level was not related to plumage coloration suggesting that this androgen is not required for the expression of this plumage trait. Our study therefore indicates that in the barn owl colour polymorphism plays no role in the probability of producing extra-pair young.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Evaluation of an average numerator relationship matrix model and a Bayesian hierarchical model for growth traits in Nellore cattle with uncertain paternity

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of nine microsatellite loci and misidentification paternity frequency in a population of Gyr breed bovines

Erros de identificação de paternidade são prejudiciais por reduzir o ganho genético anual e comprometer um programa eficiente de melhoramento genético. O objetivo principal deste trabalho foi avaliar o potencial de uso de nove microssatélites em testes de paternidade e investigar a freqüência de erro de identificação de famílias de um rebanho de animais da raça Gir. No experimento foram utilizadas amostras de sangue de quarenta famílias (touro/ vaca/ bezerro) de animais da raça Gir, Puros de Origem e registrados na Associação Brasileira dos Criadores de Zebu (ABCZ). A maior parte dos microssatélites avaliados neste trabalho são recomendados, para Testes de Paternidade em bovinos, pela Sociedade Internacional de Genética Animal (ISAG). As regiões microssatélites TGLA122, TGLA126, BM1824, BMS2533, SPS115, ETH3, ETH10, ETH225 e POTCHA foram amplificadas por meio da técnica de PCR. Os produtos da amplificação foram separados por eletroforese em gel de poliacrilamida desnaturante. A partir dos dados obtidos foram calculadas as freqüências alélicas, diversidade gênica, conteúdo de polimorfismo informativo e probabilidade de exclusão para cada microssatélite. Também foram calculadas as freqüências genotípicas, heterozigosidade, probabilidade de exclusão combinada e probabilidade de Paternidade nas famílias consideradas. A probabilidade de exclusão combinada para todos os microssatélites estudados foi de 0,9789. Os resultados dos testes de paternidade acusaram erro de identificação em onze das 40 famílias estudadas, ou seja, 27,5% da amostra. A probabilidade de paternidade variou entre 0,8691 e 0,9999, com valor médio de 0,9512.

Contemporary pollen flow, mating patterns and effective population size inferred from paternity analysis in a small fragmented population of the Neotropical tree Copaifera langsdorffii Desf. (Leguminosae-Caesalpinioideae)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Genetic data of 15 autosomal STR loci: an analysis of the Araraquara population colonization (São Paulo, Brazil)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Paternity study of an interspecific natural hybrid of the genus Eucalyptus L'Hér (Myrtaceae) based on cytogenetic data

Three species of the genus Eucalyptus (E. dunni, E. grandis, E. saligna) and interspecific hybrid were studied cytogenetically. The Eucalyptus species and the hybrid showed a symmetrical karyotype with 2n=22 chromosomes, with chromosome length ranging from 0.67 to 1.39 μm. Karyotypic analysis indicated a homogenous morphology and chromosome number for the species and the hybrid studied here. Based on the karyotype asymmetry data, together with the chromosome morphology results, the hybrid presented close similarity to E. saligna, suggesting that the latter is one of the parental species involved in the production of the hybrid.

Genetic population data from Araraquara region (SP State, Brazil) using PowerPlex® 16 Systems

In the present study, allele frequency distributions for the 15 STR loci included in the PowerPlex® 16 Systems (Promega) were obtained from a sample of 55 unrelated individuals living in Araraquara region (SP, Brazil). The frequency of each allele for each locus tested, the exact test and the forensic and paternity parameters were calculated using POWERSTATS ver. 1.2 (Promega) and GENEPOP ver. 3.2 software. All loci are in the Hardy-Weinberg equilibrium and they reached a combined power discrimination of 0.999999999999999973 and combined power exclusion of 0.99999987, showing to be a powerful tool for paternity testing and individual identification in the population analyzed. © 2005 Elsevier B.V. All rights reserved.

Population genetic data of five X-chromosomal loci in Bauru (São Paulo, Brazil)

Genetic population data for five X-STR (DXS6854, DXS7424, DXS101, DXS6808 and DXS7132) were obtained from Bauru population (São Paulo, Brazil). No deviations from the Hardy-Weinberg equilibrium were observed, with the exception of DXS101. The combined powers of discrimination in males and females were 0.99897253 and 0.99999120, respectively. These high values show the potential of this system in human identification and paternity testing. © 2008 Elsevier B.V. All rights reserved.

Biochemical polymorphisms and genetic relationships between Brazilian and foreign breeds of pigs reared in Brazil

Foi investigada a variabilidade genética de 14 sistemas protéicos codificados por 15 locos estruturais em amostras de sangue de suínos das raças Piau e Caruncho. Os resultados foram comparados com àqueles obtidos previamente para amostras de Landrace, Large White, Duroc e Mouro. O grau de variabilidade genética obtida para Piau (He=0,114) foi similar àquelas estimadas para outras raças criadas no Brasil (Landrace, He=0,116; Large White, He=0,119; Duroc, 0,095; Mouro, He= 0,130). Caruncho apresentou a menor variabilidade (He= 0,056). A partir das freqüências gênicas dos locos polimórficos, foi calculada a eficiência de cada sistema para testes de paternidade e as probabilidades combinadas de exclusão de paternidade foram estimadas em 58% para Piau e 36% para Caruncho. Análises das distâncias genéticas revelaram que a raça mais próxima da Piau foi a Landrace (D=0,042). Caruncho apresentou as maiores divergências em relação a todas as raças comparadas, que variaram de 0,107 (com Landrace) a 0,176 (com Duroc). A árvore construída através de UPGMA e Distância de Rogers mostrou uma topologia na qual Piau e Mouro se uniram as raças Européias (Landrace e Large White), e Caruncho está separado de todas as demais raças. Os resultados das análises das amostras de Caruncho devem ser interpretados com cautela, uma vez que o número de animais estudados foi pequeno.

Paternity identification in sugarcane polycrosses by using microsatellite markers

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Genetic resource impacts of habitat loss and degradation; reconciling empirical evidence and predicted theory for neotropical trees

The theoretical impacts of anthropogenic habitat degradation on genetic resources have been well articulated. Here we use a simulation approach to assess the magnitude of expected genetic change, and review 31 studies of 23 neotropical tree species to assess whether empirical case studies conform to theory. Major differences in the sensitivity of measures to detect the genetic health of degraded populations were obvious. Most studies employing genetic diversity (nine out of 13) found no significant consequences, yet most that assessed progeny inbreeding (six out of eight), reproductive output (seven out of 10) and fitness (all six) highlighted significant impacts. These observations are in line with theory, where inbreeding is observed immediately following impact, but genetic diversity is lost slowly over subsequent generations, which for trees may take decades. Studies also highlight the ecological, not just genetic, consequences of habitat degradation that can cause reduced seed set and progeny fitness. Unexpectedly, two studies examining pollen flow using paternity analysis highlight an extensive network of gene flow at smaller spatial scales (less than 10 km). Gene flow can thus mitigate against loss of genetic diversity and assist in long-term population viability, even in degraded landscapes. Unfortunately, the surveyed studies were too few and heterogeneous to examine concepts of population size thresholds and genetic resilience in relation to life history. Future suggested research priorities include undertaking integrated studies on a range of species in the same landscapes; better documentation of the extent and duration of impact; and most importantly, combining neutral marker, pollination dynamics, ecological consequences, and progeny fitness assessment within single studies.

Evaluation of male breeding population inferred from paternity analyses in the Cape Verde islands

[EN] Because of the extensive migrations of marine turtles through the ocean, many aspects of their biology have been unknown for a long time. However, much information has been recently gained from genetic studies and population monitoring of female turtles at their nesting sites. In contrast, still very little is known on the genetic diversity, population structure and dispersal patterns of the male breeding population, mainly because of the difficulty of capturing and monitoring them at sea. The aim of this study is to assess the genetic patterns of the male breeding population of the loggerhead turtle, Caretta caretta, using a non invasive approach and compare them to the female breeding population.

Genetic Aspects Of Athletic Performance: The African Runners Phenomenon.

The current dominance of African runners in long-distance running is an intriguing phenomenon that highlights the close relationship between genetics and physical performance. Many factors in the interesting interaction between genotype and phenotype (eg, high cardiorespiratory fitness, higher hemoglobin concentration, good metabolic efficiency, muscle fiber composition, enzyme profile, diet, altitude training, and psychological aspects) have been proposed in the attempt to explain the extraordinary success of these runners. Increasing evidence shows that genetics may be a determining factor in physical and athletic performance. But, could this also be true for African long-distance runners? Based on this question, this brief review proposed the role of genetic factors (mitochondrial deoxyribonucleic acid, the Y chromosome, and the angiotensin-converting enzyme and the alpha-actinin-3 genes) in the amazing athletic performance observed in African runners, especially the Kenyans and Ethiopians, despite their environmental constraints.