949 resultados para Dinucleotide Repeat Polymorphism
Resumo:
GABAergic systems have been implicated in the pathogenesis of anxiety, depression and insomnia. These symptoms are part of the core and comorbid psychiatric disturbances in post-traumatic stress disorder (PTSD) In a sample of Caucasian male PTSD patients, dinucleotide repeat polymorphisms of the GABAA receptor beta3 subunit gene were compared to scores on the General Health Questionnaire-28 (GHQ). As the major allele at this gene locus (GABRB3) was GI, the alleles were divided into GI and non-GI groups. On the total score of the GHQ, which comprises the somatic symptoms, anxiety/insomnia, social dysfunction and depression subscales, patients with the GI non-GI genotype had a significantly higher score when compared to either the G1G1 genotype (alpha = 0.01) or the non-GI non-GI genotype (alpha = 0.05). No significant difference was found between the G1G1 and non-Gl non-G1 genotypes. When the GI non-G1 heterozygotes were compared to the combined G1G1 and non-GI non-GI homozygotes, a significantly higher total GHQ score was found in the heterozygotes (P = 0.002). These observations suggest a heterosis effect. Further analysis of GHQ subscale scores showed that heterozygotes compared to the combined homozygotes had higher scores on the somatic symptoms (P = 0.006), anxiety/insomnia (P = 0.003), social dysfunction (P = 0.054) and depression (P = 0.004) subscales. In conclusion, the present study indicates that in a population of PTSD patients, heterozygosity of the GABRB3 major (GI) allele confers higher levels of somatic symptoms, anxiety/insomnia, social dysfunction and depression than found in homozygosity. (C) 2001 Elsevier Science Ireland Ltd. All rights reserved.
Resumo:
The interaction between genetic and environmental factors for PD was examined in a Chinese population. It was found that although the intron 2 MAOB (GT)(n) repeat polymorphism was not associated with PID in the population, a relationship might have been masked by the protective effect of tea drinking. In individuals who did not drink tea (<1 cup/day), the possession of short length less than or equal to 178 bp (GT), alleles conferred a borderline significant increased risk for PD (adjusted OR = 1.47; C.l. = 1.03-2. 1). As the extent of tea consumption increased, the association between the less than or equal to178 bp allele and PD disappeared. This result suggests that the MAOB gene may be associated with PD in Chinese if the putative protective effect of tea drinking is taken into account. The significance of this finding is unclear as the study may be limited because of its marginal significance and limited numbers. However, it does demonstrate the importance of considering putative positive and negative environmental risk factors in any examination of genetic risk factors for PD. (C) 2003 Elsevier Science Ltd. All rights reserved.
Resumo:
Thymidylate synthase, as a rate-limiting step in DNA synthesis, catalyses the conversion of dUMP into dTMP using 5,10-methylenotetrahydrofolate as the methyl donor. Two polymorphisms have been described in this gene: a repeat polymorphism in the 5' promoter enhancer region (3R versus 2R) and a 6 bp deletion in the 3' unstranslated region. Both of these may affect protein levels. The present case control study was aimed at investigating the influence of these two polymorphisms on the development of colorectal cancer (CRC), as well as their potential interaction with folate, vitamin B6 and vitamin B12 intake. A total of 196 cases and 200 controls, matched for age and sex distribution, were included in the study. No association was found between CRC and the 28 bp repeat polymorphism, but it was observed that individuals with the 6 bp/del and del/del genotypes had a significantly lower risk of developing the disease (OR=0.47; 95% CI 0.30-0.72). A combined genotype (2R/2R; 6 bp/del+del/del) was also found, which was associated with an even lower risk of developing of the disease (OR=0.42; 95% CI 0.26-0.69). No significant interaction between these polymorphisms and vitamin intake was observed. These results indicate for the first time that the 6 bp/del allele might be a protective factor in the development of CRC, independent of the intake of methyl group donors.
Resumo:
The genetic characterization of unbalanced mixed stains remains an important area where improvementis imperative. Most cases of aggression, homicide and sexual assault produce biological traces withrelatively large amount of the victim's DNA and small amount of the aggressor's DNA. If this ratio issmaller than 1:10 it is currently not possible to obtain a conventional autosomal DNA profile of the minorcontributor, with potential loss of crucial DNA evidence. Y-STR analysis represents a solution for somecases but has several limitations. We propose here a method based on a new compound genetic markerformed by a Deletion/Insertion Polymorphism (DIP) linked to a Short Tandem Repeat polymorphism(STR), that we name DIP-STR. By means of allele-specific amplifications of DIP-STR haplotypes, we canproduce a high resolution autosomal DNA profile of a donor that contributes less than 0.1% to a DNAmixture. Based on these features DIP-STR markers may outperform conventional Y-STR markers inmixed stain analysis.
Resumo:
Nonsyndromic oral clefts (NSOC) are the most common craniofacial birth defects in humans. The etiology of NSOC is complex, involving both genetic and environmental factors. Several genes that play a role in cellular proliferation, differentiation, and apoptosis have been associated with clefting. For example, variations in the homeobox gene family member MSX1, including a CA repeat located within its single intron, may play a role in clefting. The aim of this study was to investigate the association between MSX1CA repeat polymorphism and NSOC in a Southern Brazilian population using a case-parent triad design. We studied 182 nuclear families with NSOC recruited from the Hospital de Clínicas de Porto Alegre in Southern Brazil. The polymorphic region was amplified by the polymerase chain reaction and analyzed by using an automated sequencer. Among the 182 families studied, four different alleles were observed, at frequencies of 0.057 (175 bp), 0.169 (173 bp), 0.096 (171 bp) and 0.67 (169 bp). A transmission disequilibrium test with a family-based association test (FBAT) software program was used for analysis. FBAT analysis showed overtransmission of the 169 bp allele in NSOC (P=0.0005). These results suggest that the CA repeat polymorphism of theMSX1 gene may play a role in risk of NSOC in populations from Southern Brazil.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
BACKGROUND: Tumor necrosis factor-alpha (TNF-alpha) and interleukin-1beta (IL-1beta), produced by endotoxin-activated Kupffer cells, play a key role in the pathogenesis of alcoholic liver cirrhosis (ALC). Alleles TNFA -238A, IL1B -31T and variant IL1RN*2 of repeat polymorphism in the gene encoding the IL-1 receptor antagonist increase production of TNF-alpha and IL-1beta, respectively. Alleles CD14 -159T, TLR4 c.896G and TLR4 c.1196T modify activation of Kupffer cells by endotoxin. We confirmed the published associations between these common variants and genetic predisposition to ALC by means of a large case-control association study conducted on two Central European populations. METHODS: The study population comprised a Czech sample of 198 ALC patients and 370 controls (MONICA project), and a German sample of 173 ALC patients and 331 controls (KORA-Augsburg), and 109 heavy drinkers without liver disease. RESULTS: Single locus analysis revealed no significant difference between patients and controls in all tested loci. Diplotype [IL1RN 2/ 2; IL1B -31T+] was associated with increased risk of ALC in the pilot study, but not in the validation samples. CONCLUSIONS: Although cytokine mediated immune reactions play a role in the pathogenesis of ALC, hereditary susceptibility caused by variants in the corresponding genes is low in Central European populations.
Resumo:
The myogenin gene encodes an evolutionarily conserved basic helix-loop-helix transcription factor that regulates the expression of skeletal muscle-specific genes and its homozygous deletion results in mice who die of respiratory failure at birth. The histology of skeletal muscle in the myogenin null mice is reminiscent of that found in some severe congenital myopathy patients, many of whom also die of respiratory complications and provides the rationale that an aberrant human myogenin (myf4) coding region could be associated with some congenital myopathy conditions.^ With PCR, we found similarly sized amplimers for the three exons of the myogenin gene in 37 patient and 40 control samples. In contrast to the GeneBank sequence for human myogenin, we report several differences in flanking and coding regions plus an additional 659 and 498 bps in the first and second introns, respectively, in all patients and controls. We also find a novel (CA)-dinucleotide repeat in the second intron. No causative mutations were detected in the myogenin coding regions of genomic DNA from patients with severe congenital myopathy.^ Severe congenital myopathies in humans are often associated with respiratory complications and pulmonary hypoplasia. We have employed the myogenin null mouse, which lacks normal development of skeletal muscle fibers as a genetically defined severe congenital myopathy mouse model to evaluate the effect of absent fetal breathing movement on pulmonary development.^ Significant differences are observed at embryonic days E14, E17 and E20 of lung:body weight, total DNA and histologically, suggesting that the myogenin null lungs are hypoplastic. RT-PCR, in-situ immunofluorescence and EM reveal pneumocyte type II differentiation in both null and wild lungs as early as E14. However, at E14, myogenin null lungs have decreased BrdU incorporation while E17 through term, augmented cell death is detected in the myogenin null lungs, not seen in wild littermates. Absent mechanical forces appear to impair normal growth, but not maturation, of the developing lungs in myogenin null mouse.^ These investigations provide the basis for delineating the DNA sequence of the myogenin gene and and highlight the importance of skeletal muscle development in utero for normal lung organogenesis. My observation of no mutations within the coding regions of the human myogenin gene in DNA from patients with severe congenital myopathy do not support any association with this condition. ^
Resumo:
The comparative typing of matched tumor and blood DNAs at dinucleotide repeat (microsatellite) loci has revealed in tumor DNA the presence of alleles that are not observed in normal DNA. The occurrence of these additional alleles is possibly due to replication errors (RERs). Although this observation has led to the recognition of a subtype of colorectal cancer with a high incidence of RERs (caused by a deficiency in DNA mismatch repair), a thorough analysis of the RER frequency in a consecutive series of colorectal cancers had not been reported. It is shown here that the extensive typing of 88 colorectal tumors reveals a bimodal distribution for the frequency of RER at microsatellite loci. Within the major mode (75 tumors, RER− subtype), the probability that a locus exhibited instability did not differ significantly among loci and tumors, being 0.02. The subsequent development of a statistical test for an operational discrimination between the RER− and RER+ subtypes indicated that the probability of misclassification did not exceed 0.001 in this series. The frequency of K-ras mutation was found to be equivalent in the two subtypes. However, in the RER+ tumors, the p53 gene mutation was less frequently detected, the adenomatous polyposis coli (APC) mutation was rare, and the biallelic inactivation of either of these genes was not observed. Furthermore, the concomitant occurrence of APC and tumor growth factor β receptor type II gene alterations was found only once. These data suggest that the repertoires of genes that are frequently altered in RER+ and RER− tumors may be more different than previously thought.
Resumo:
The dopamine D4 receptor gene contains a polymorphic sequence consisting of a variable number of 48-base-pair (bp) repeats, and there have been a number of reports that this polymorphism is associated with variation in novelty seeking or in substance abuse and addictive behaviors. In this study we have assessed the linkage and association of DRD4 genotype with novelty seeking, alcohol use, and smoking in a sample of 377 dizygotic twin pairs and 15 single twins recruited from the Australian Twin Registry (ATR). We found no evidence of linkage or association of the DRD4 locus with any of the phenotypes. We made use of repeated measures for some phenotypes to increase power by multivariate genetic analysis, but allelic effects were still non-significant. Specifically, it has been suggested that the DRD4 7-repeat allele is associated with increased novelty seeking in males but we found no evidence for this, despite considerable power to do so. We conclude that DRD4 variation does not have an effect on use of alcohol and the problems that arise from it, on smoking, or on novelty seeking behavior. (C) 2003 Wiley-Liss, Inc.
Resumo:
The advent of novel biological therapies for the treatment of rheumatic disease has renewed interest in the seronegative spondyloarthropathies (SpAs). International efforts are redefining disease classification and measures of disease activity, outcome, metrology, and imaging. However, opinion is divided between those who propose that the SpA group represents the same disease with variable expression (the lumpers) and those who consider these to be separate diseases with shared clinical features (the splitters). This review presents the evidence for both approaches.
Resumo:
We report the clinical characteristics of a schizophrenia sample of 409 pedigrees-263 of European ancestry ( EA) and 146 of African American ancestry ( AA)-together with the results of a genome scan ( with a simple tandem repeat polymorphism interval of 9 cM) and follow-up fine mapping. A family was required to have a proband with schizophrenia ( SZ) and one or more siblings of the proband with SZ or schizoaffective disorder. Linkage analyses included 403 independent full-sibling affected sibling pairs ( ASPs) ( 279 EA and 124 AA) and 100 all-possible half-sibling ASPs ( 15 EA and 85 AA). Nonparametric multipoint linkage analysis of all families detected two regions with suggestive evidence of linkage at 8p23.3-q12 and 11p11.2-q22.3 ( empirical Z likelihood-ratio score [ Z(lr)] threshold >= 2.65) and, in exploratory analyses, two other regions at 4p16.1-p15.32 in AA families and at 5p14.3-q11.2 in EA families. The most significant linkage peak was in chromosome 8p; its signal was mainly driven by the EA families. Z(lr) scores >= 2.0 in 8p were observed from 30.7 cM to 61.7 cM ( Center for Inherited Disease Research map locations). The maximum evidence in the full sample was a multipoint Z(lr) of 3.25 ( equivalent Kong-Cox LOD of 2.30) near D8S1771 ( at 52 cM); there appeared to be two peaks, both telomeric to neuregulin 1 ( NRG1). There is a paracentric inversion common in EA individuals within this region, the effect of which on the linkage evidence remains unknown in this and in other previously analyzed samples. Fine mapping of 8p did not significantly alter the significance or length of the peak. We also performed fine mapping of 4p16.3-p15.2, 5p15.2-q13.3, 10p15.3-p14, 10q25.3-q26.3, and 11p13-q23.3. The highest increase in Z(lr) scores was observed for 5p14.1-q12.1, where the maximum Z(lr) increased from 2.77 initially to 3.80 after fine mapping in the EA families.
Resumo:
In Brazil, human T-lymphotropic virus type 2 (HTLV-2) is endemic in Amerindians and epidemic in intravenous drug users (IDUs). The long terminal repeat (LTR) is the most divergent genomic region of HTLV-2, therefore useful to characterize subtypes. Nucleotide sequence and restriction fragment length polymorphism (RFLP) analysis of LTR genomic segments of fourteen HTLV-2 strains isolated from HIV-infected patients of Londrina, Southern Brazil, were carried out. Molecular analysis disclosed that all HTLV-2 strains belonged to 2a subtype, and RFLP detected the presence of the a4, a5, and a6 subgroups according to Switzer's nomenclature. RFLP correlated with nucleotide sequence, and phylogenetic analysis clustered HTLV-2 sequences of IDUs into subgroups a5 and a6. HTLV-2 sequences from individuals of sexual risk factor clustered into the a4 subgroup. These results extend the knowledge of the genetic diversity of HTLV-2 circulating in Brazil and provide insights into HTLV-2 transmission and virus movement in this geographic area.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).