DNA knots and DNA supercoiling.

Comment on: Witz G, et al. Proc Natl Acad Sci USA 2011; 108:3608-11.

DNA Sequence Representation methods

DNA sequence representation methods are used to denote a gene structure effectively and help in similarities/dissimilarities analysis of coding sequences. Many different kinds of representations have been proposed in the literature. They can be broadly classified into Numerical, Graphical, Geometrical and Hybrid representation methods. DNA structure and function analysis are made easy with graphical and geometrical representation methods since it gives visual representation of a DNA structure. In numerical method, numerical values are assigned to a sequence and digital signal processing methods are used to analyze the sequence. Hybrid approaches are also reported in the literature to analyze DNA sequences. This paper reviews the latest developments in DNA Sequence representation methods. We also present a taxonomy of various methods. A comparison of these methods where ever possible is also done

Electronic couplings and on-site energies for hole transfer in DNA: systematic quantum mechanical/molecular dynamic study

The electron hole transfer (HT) properties of DNA are substantially affected by thermal fluctuations of the π stack structure. Depending on the mutual position of neighboring nucleobases, electronic coupling V may change by several orders of magnitude. In the present paper, we report the results of systematic QM/molecular dynamic (MD) calculations of the electronic couplings and on-site energies for the hole transfer. Based on 15 ns MD trajectories for several DNA oligomers, we calculate the average coupling squares 〈 V2 〉 and the energies of basepair triplets X G+ Y and X A+ Y, where X, Y=G, A, T, and C. For each of the 32 systems, 15 000 conformations separated by 1 ps are considered. The three-state generalized Mulliken-Hush method is used to derive electronic couplings for HT between neighboring basepairs. The adiabatic energies and dipole moment matrix elements are computed within the INDO/S method. We compare the rms values of V with the couplings estimated for the idealized B -DNA structure and show that in several important cases the couplings calculated for the idealized B -DNA structure are considerably underestimated. The rms values for intrastrand couplings G-G, A-A, G-A, and A-G are found to be similar, ∼0.07 eV, while the interstrand couplings are quite different. The energies of hole states G+ and A+ in the stack depend on the nature of the neighboring pairs. The X G+ Y are by 0.5 eV more stable than X A+ Y. The thermal fluctuations of the DNA structure facilitate the HT process from guanine to adenine. The tabulated couplings and on-site energies can be used as reference parameters in theoretical and computational studies of HT processes in DNA

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structural characterisation of bisintercalation in higher-order DNA at a junction-like quadruplex

We report the single-crystal X-ray structure for the complex of the bisacridine bis-(9-aminooctyl(2-(dimethylaminoethyl)acridine-4-carboxamide)) with the oligonucleotide d(CGTACG)2 to a resolution of 2.4 Å. Solution studies with closed circular DNA show this compound to be a bisintercalating threading agent, but so far we have no crystallographic or NMR structural data conforming to the model of contiguous intercalation within the same duplex. Here, with the hexameric duplex d(CGTACG), the DNA is observed to undergo a terminal cytosine base exchange to yield an unusual guanine quadruplex intercalation site through which the bisacridine threads its octamethylene linker to fuse two DNA duplexes. The 4-carboxamide side-chains form anchoring hydrogen-bonding interactions with guanine O6 atoms on each side of the quadruplex. This higher-order DNA structure provides insight into an unexpected property of bisintercalating threading agents, and suggests the idea of targeting such compounds specifically at four-way DNA junctions.

Double-strand DNA cleavage induced by oxindole-Schiff base copper(II) complexes with potential antitumor activity

Some oxindole-Schiff base copper(II) complexes have already shown potential antitumor activity towards different cells, inducing apoptosis in a process modulated by the ligand, and having nuclei and mitochondria as main targets. Here, three novel copper(II) complexes with analogous ligands were isolated and characterized by spectroscopic techniques, having their reactivity compared to the so far most active complex in this class. Cytotoxicity experiments carried out toward human neuroblastoma SH-SY5Y cells confirmed its proapoptosis property. DNA cleavage studies were then performed in the presence of these complexes, in order to verify the influence of ligand structural features in its nuclease activity. All of them were able to cause double-strand DNA scissions, giving rise to nicked circular Form II and linear Form III species, in the presence of hydrogen peroxide. Additionally, DNA Form II was also detected in the absence of peroxide when the most active complex, [Cu(isaepy)(2)](2+) 1, was used. In an effort to better elucidate their interactions with DNA, solutions of the different complexes titrated with DNA had their absorption spectra monitored. An absorbance hyperchromism observed at 260 nm pointed to the intercalation of these complexes into the DNA structure. Further, investigations of 2-deoxy-D-ribose (DR) oxidation catalyzed by each of those complexes, using 2-thiobarbituric acid reactive species (TBARS) method, and detection of reactive oxygen species (ROS) formation by spin-trapping EPR, suggested that their mechanism of action in performing efficiently DNA cleavage occurs preferentially, but not only by oxidative pathways. (C) 2007 Elsevier Inc. All rights reserved.

Genetic diversity in wild (Sus scrofa scrofa) and domestic (Sus scrofa domestica) pigs and their hybrids based on polymorphism of a fragment of the D-loop region in the mitochondrial DNA

We examined the variation in mitochondrial DNA by sequencing the D-loop region in wild and domestic (large-white breed) pigs, in hybrids between domestic and wild pigs, and in Monteiro pigs. A D-loop fragment of approximately 330 bp was amplified by PCR. Sequencing of DNA amplicons identified haplotypes previously described as European and Asian types. Monteiro pigs and wild pigs had European haplotypes and domestic pigs had both European and Asian haplotypes. ©FUNPEC-RP.

Evaluation of the interactions of DNA with the textile dyes Disperse Orange 1 and Disperse Red 1 and their electrolysis products using an electrochemical biosensor

A disposable pencil graphite electrode modified with dsDNA was used in combination with square wave voltammetry in order to evaluate the interaction of DNA with the textile dyes Disperse Orange 1 (DO1) and Disperse Red 1 (DR1), and with the products of their electrolysis. Significant changes in the characteristic oxidation peaks of the guanine and adenine moieties of immobilized dsDNA were observed after incubation of the modified electrode for 180 s in solutions of the dyes in their original forms. The same was observed using the electrolysis products obtained by oxidation and reduction conversions. The oxidation peak currents of the guanine and adenine moieties decreased when the concentrations of DO1 and DR1 were increased up to 5.0 × 10 -6 and 1.0 × 10-6 mol L-1, respectively; the signal decreases were more pronounced after interaction with the oxidized dyes, compared to the reduced compounds. The interactions between DNA and DO1, DR1, and the electrolyzed dyes were further investigated by UV-vis spectrophotometry in solution, and different effects such as hypochromism and hyperchromism were observed in the resulting DNA spectra. The investigated interactions showed clear evidence of changes in the DNA structure, and suggested a predominant intercalation mode leading to damage in the biomolecule. © 2013 Elsevier B.V.

Structural modification of DNA--a therapeutic option in SLE?

Systemic lupus erythematosus (SLE) is an autoimmune disease that affects multiple organs, with glomerulonephritis representing a frequent and serious manifestation. SLE is characterized by the presence of various autoantibodies, including anti-DNA antibodies that occur in approximately 70% of patients with SLE and which contribute to disease pathogenesis. Consequently, immunosuppressive therapies are applied in the treatment of SLE to reduce autoantibody levels. However, increasing evidence suggests that DNA--especially double--stranded DNA-constitutes an important pathogenic factor that is able to activate inflammatory responses by itself in autoimmune diseases. Therefore, modifying the structure of DNA to reduce its pathogenicity might be a more targeted approach for the treatment of SLE than immunosuppression. This article presents information in support of this strategy, and discusses the potential methods of DNA structure manipulation--in light of data obtained from mouse models of SLE--including topoisomerase I inhibition, administration of DNase I, or modification of histones using heparin or histone deacetylase inhibitors.

Combinatorial chromophore assembly inside a DNA four-way junction

In 1964 first proposed by Robin Holliday as a mechanistic model to solve the mystery of how genetic information is exchanged in yeast, the DNA four-way junction or Holliday junction (HJ) was proofed to be the key in- termediate in homologous recombination and became an important tool in the field of DNA origami, computation and nanomachines. Herein we use the assembly of four modified nucleic acid strands into the planar square conformation of this higher order DNA structure to demonstrate in a proof of principle manner the cumulative effect of pyrene moieties interacting inside the junction.[1][2]

AN ANALYSIS OF THE DNA DAMAGE INDUCED BY NICKEL COMPOUNDS IN CHINESE HAMSTER OVARY CELLS (CARCINOGENESIS, HETEROCHROMATIN, CYTOTOXICITY, REPLICATION, PROTEIN CROSSLINKING)

The carcinogenic activity of water-insoluble crystalline nickel sulfide requires phagocytosis and lysosome-mediated intracellular dissolution of the particles to yield Ni('2+). This study investigated the extent and nature of the DNA damage in Chinese hamster ovary cells treated with various nickel compounds using the technique of alkaline elution. Crystalline NiS and water-soluble NiCl(,2) induced single strand breaks that were repaired quickly and DNA-protein crosslinks that persisted up to 24 hr after exposure to nickel. The induction of single strand breaks was concentration dependent at both noncytotoxic and lethal amounts of nickel. The induction of DNA-protein crosslinks was concentration dependent but was absent at lethal amounts of nickel. The cytoplasmic and nuclear uptake of nickel was concentration dependent even at the toxic level of nickel. However, the induction of DNA-protein crosslinks by nickel required active cell cycling and occurred predominantly in mid-late S phase of the cell cycle, suggesting that the lethal amounts of nickel inhibited DNA-protein crosslinking by inhibiting active cell cycling. Since the DNA-protein crosslinking induced by nickel was resistant to DNA repair, the nature of this lesion was investigated using various methods of DNA isolation and chromatin fractionation in combination with SDS-polyacrylamide gel electrophoresis. High molecular weight, non-histone chromosomal proteins and possibly histone 1 were preferentially crosslinked to DNA by nickel. The crosslinked proteins were concentrated in a magnesium-insoluble fraction of sonicated chromatin (5% of the total) that was similar to heterochromatin in solubility and protein composition. Alterations in DNA structure and function, brought about by the effect of nickel on protein-DNA interactions, may be related to the carcinogenicity of nickel compounds. ^

Assembling Multiporphyrin Stacks Inside the DNA Double Helix

Double stranded DNA hybrids containing up to four consecutive, face-to-face stacked porphyrins are described. Non-nucleosidic, 5,15-bisphenyl-substituted porphyrin building blocks were incorporated into complementary oligonucleotide strands. Upon hybridization multiple porphyrins are well accommodated inside the DNA scaffold without disturbing the overall B-DNA structure. The formation of double strands containing up to four free base porphyrins is enabled without compromising duplex stability. UV/vis, fluorescence, and CD spectroscopy demonstrate the formation of porphyrins H-aggregates inside the DNA double helix and provide evidence for the existence of strong excitonic coupling between interstrand stacked porphyrins. H-aggregation results in considerable fluorescence quenching. Most intense CD effects are observed in stacks containing four porphyrins. The findings demonstrate the value of DNA for the controlled formation of molecularly defined porphyrin aggregates.

Non B-DNA structures and genomic instability associated with myotonic dystrophy type 2 (CCTG).(CAGG) repeats

There are many diseases associated with the expansion of DNA repeats in humans. Myotonic dystrophy type 2 is one of such diseases, characterized by expansions of a (CCTG)•(CAGG) repeat tract in intron 1 of zinc finger protein 9 (ZNF9) in chromosome 3q21.3. The DM2 repeat tract contains a flanking region 5' to the tract that consists of a polymorphic repetitive sequence (TG)14-25(TCTG)4-11(CCTG) n. The (CCTG)•(CAGG) repeat is typically 11-26 repeats in persons without the disease, but can expand up to 11,000 repeats in affected individuals, which is the largest expansion seen in DNA repeat diseases to date. This DNA tract remains one of the least characterized disease-associated DNA repeats, and mechanisms causing the repeat expansion in humans have yet to be elucidated. Alternative, non B-DNA structures formed by the expanded repeats are typical in DNA repeat expansion diseases. These sequences may promote instability of the repeat tracts. I determined that slipped strand structure formation occurs for (CCTG)•(CAGG) repeats at a length of 42 or more. In addition, Z-DNA structure forms in the flanking human sequence adjacent to the (CCTG)•(CAGG) repeat tract. I have also performed genetic assays in E. coli cells and results indicate that the (CCTG)•(CAGG) repeats are more similar to the highly unstable (CTG)•(CAG) repeat tracts seen in Huntington's disease and myotonic dystrophy type 1, than to those of the more stable (ATTCT)•(AGAAT) repeat tracts of spinocerebellar ataxia type 10. This instability, however, is RecA-independent in the (CCTG)•(CAGG) and (ATTCT)•(AGAAT) repeats, whereas the instability is RecA-dependent in the (CTG)•(CAG) repeats. Structural studies of the (CCTG)•(CAGG) repeat tract and the flanking sequence, as well as genetic selection assays may reveal the mechanisms responsible for the repeat instability in E. coli, and this may lead to a better understanding of the mechanisms contributing to the human disease state. ^

RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions.

Enzyme plus light therapy to repair DNA damage in ultraviolet-B-irradiated human skin

Ultraviolet-B (UVB) (290–320 nm) radiation-induced cyclobutane pyrimidine dimers within the DNA of epidermal cells are detrimental to human health by causing mutations and immunosuppressive effects that presumably contribute to photocarcinogenesis. Conventional photoprotection by sunscreens is exclusively prophylactic in nature and of no value once DNA damage has occurred. In this paper, we have therefore assessed whether it is possible to repair UVB radiation-induced DNA damage through topical application of the DNA-repair enzyme photolyase, derived from Anacystis nidulans, that specifically converts cyclobutane dimers into their original DNA structure after exposure to photoreactivating light. When a dose of UVB radiation sufficient to induce erythema was administered to the skin of healthy subjects, significant numbers of dimers were formed within epidermal cells. Topical application of photolyase-containing liposomes to UVB-irradiated skin and subsequent exposure to photoreactivating light decreased the number of UVB radiation-induced dimers by 40–45%. No reduction was observed if the liposomes were not filled with photolyase or if photoreactivating exposure preceded the application of filled liposomes. The UVB dose administered resulted in suppression of intercellular adhesion molecule-1 (ICAM-1), a molecule required for immunity and inflammatory events in the epidermis. In addition, in subjects hypersensitive to nickel sulfate, elicitation of the hypersensitivity reaction in irradiated skin areas was prevented. Photolyase-induced dimer repair completely prevented these UVB radiation-induced immunosuppressive effects as well as erythema and sunburn-cell formation. These studies demonstrate that topical application of photolyase is effective in dimer reversal and thereby leads to immunoprotection.