Oestrogen and Progesterone Receptor Gene Expression in Canine Oocytes and Cumulus Cells Throughout the Oestrous Cycle

The aim of this research was to analyze oestrogen receptor-alpha (ER alpha), ER beta and progesterone receptor (PR) gene expression in the canine oocyte and cumulus cells throughout the oestrous cycle. Ovaries from 38 bitches were recovered after ovariohysterectomy and sliced. The phase of the oestrous cycle was determined by vaginal cytology, vaginoscopy and serum hormonal measurements. Oocytes were mechanically denuded by repeated pipetting. For each phase of the cycle, a sample was composed by a pool of 50 oocytes (sample number: prooestrus = 3, oestrus = 8, dioestrus = 5 and anoestrus = 5) or a pool of cumulus cells (prooestrus = 4, oestrus = 7, dioestrus = 4 and anoestrus = 6). Oocyte and cumulus cells` total RNA was isolated and reverse transcription was conducted to perform real-time PCR. Oestrogen receptor-alpha was expressed throughout the cycle in the oocyte (33.33%, 25.0%, 20.0% and 60.0% for prooestrus, oestrus, dioestrus and anoestrus, respectively) and cumulus cells (50.0%, 47.14%, 25.0% and 66.67% for prooestrus, oestrus, dioestrus and anoestrus, respectively). In the oocyte, the ER beta was also expressed in all phases of the cycle (33.33%, 50.0%, 20.0% and 60.0% for prooestrus, oestrus, dioestrus and anoestrus, respectively), whereas in cumulus cells, ER beta was only expressed during prooestrus (50%) and oestrus (14.29%). Interestingly, while the oocyte PR was not detected in any phase of the cycle, this receptor was expressed during prooestrus (50%), oestrus (42.86%) and anoestrus (16.67%) in cumulus cells. In conclusion, canine oocytes express ER alpha and ER beta throughout the oestrous cycle, however, there is a lack of PR expression in all these phases. Moreover, in cumulus cells, only ER alpha was expressed throughout the oestrous cycle.

Primary screening of blood donors by nat testing for HCV-RNA: development of an "in-house" method and results

An "in-house" RT-PCR method was developed that allows the simultaneous detection of the RNA of the Hepatitis C Virus (HCV) and an artificial RNA employed as an external control. Samples were analyzed in pools of 6-12 donations, each donation included in two pools, one horizontal and one vertical, permitting the immediate identification of a reactive donation, obviating the need for pool dismembering. The whole process took 6-8 hours per day and results were issued in parallel to serology. The method was shown to detect all six HCV genotypes and a sensitivity of 500 IU/mL was achieved (95% hit rate). Until July 2005, 139,678 donations were tested and 315 (0.23%) were found reactive for HCV-RNA. Except for five false-positives, all 310 presented the corresponding antibody as well, so the yield of NAT-only donations was zero, presenting a specificity of 99.83%. Detection of a window period donation, in the population studied, will probably demand testing of a larger number of donations. International experience is showing a rate of 1:200,000 - 1:500,000 of isolated HCV-RNA reactive donations.

Messenger RNA expression of transporter and ion channel genes in undifferentiated and differentiated Caco-2 cells compared to human intestines.

PURPOSE: The purpose of this work was to study the influence of cell differentiation on the mRNA expression of transporters and channels in Caco-2 cells and to assess Caco-2 cells as a model for carrier-mediated drug transport in the intestines. METHOD: Gene mRNA expression was measured using a custom-designed microarray chip with 750 deoxyoligonucleotide probes (70mers). Each oligomer was printed four times on poly-lysine-coated glass slides. Expression profiles were expressed as ratio values between fluorescence intensities of Cy3 and Cy5 dye-labeled cDNA derived from poly(A) + RNA samples of Caco-2 cells and total RNA of human intestines. RESULTS: Significant differences in the mRNA expression profile of transporters and channels were observed upon differentiation of Caco-2 cells from 5 days to 2 weeks in culture, including changes for MAT8, S-protein, and Nramp2. Comparing Caco-2 cells of different passage number revealed few changes in mRNAs except for GLUT3, which was down-regulated 2.4-fold within 13 passage numbers. Caco-2 cells had a similar expression profile when either cultured in flasks or on filters but differed more strongly from human small and large intestine, regardless of the differentiation state of Caco-2 cells. Expression of several genes highly transcribed in small or large intestines differed fourfold or more in Caco-2 cells. CONCLUSIONS: Although Caco-2 cells have proven a suitable model for studying carrier-mediated transport in human intestines, the expression of specific transporter and ion channel genes may differ substantially.

Mapping of a gene coding for a major late structural polypeptide on the vaccinia virus genome.

Cell-free translation of total RNA isolated from vaccinia virus-infected cells late in infection results in a complex mixture of polypeptides. A monospecific antibody directed against one of the major structural proteins of the virus particle immunoprecipitated a single polypeptide with a molecular weight of 11,000 (11K) from this mixture. Immunoprecipitation was therefore used to identify the structural polypeptide among the in vitro translation products of RNA purified by hybridization selection to restriction fragments of the vaccinia virus genome. This allowed us to map the mRNA coding for the 11K polypeptide to the extreme left-hand end of the HindIII E fragment. Detailed transcriptional mapping of this region of the genome by nuclease S1 analysis revealed the presence of a late RNA transcribed from the rightward-reading strand. Its 5' end mapped at ca. 130 base pairs to the left of the HindIII site at the junction between the HindIII F and E fragments. The map position of this RNA coincided precisely with the map position of the late message coding for the 11K polypeptide.

Involvement of connexin 43 in meiotic maturation of bovine oocytes.

In ovarian follicles, cumulus cells provide the oocyte with small molecules that permit growth and control maturation. These nutrients reach the germinal cell through gap junction channels, which are present between the cumulus cells and the oocyte, and between the cumulus cells. In this study the involvement of intercellular communication mediated by gap junction channels on oocyte maturation of in vitro cultured bovine cumulus-oocyte complexes (COCs) was investigated. The stages of oocyte maturation were determined by Hoechst 33342 staining, which showed that 90% of COCs placed in the maturation medium for 24 h progress to the metaphase II stage. Bovine COC gap junction communication was disrupted initially using n-alkanols, which inhibit any passage through gap junctions. In the presence of 1-heptanol (3 mmol l(-1)) or octanol (3.0 mmol l(-1) and 0.3 mmol l(-1)), only 29% of the COCs reached metaphase II. Removal of the uncoupling agent was associated with restoration of oocyte maturation, indicating that treatment with n-alkanols was neither cytotoxic nor irreversible. Concentrations of connexin 43 (Cx43), the major gap junction protein expressed in the COCs, were decreased specifically using a recombinant adenovirus expressing the antisense Cx43 cDNA (Ad-asCx43). The efficacy of adenoviral infection was > 95% in cumulus cells evaluated after infection with recombinant adenoviruses expressing the green fluorescence protein. RT-PCR performed on total RNA isolated from Ad-asCx43-infected COCs showed that the rat Cx43 cDNA was transcribed. Western blot analysis revealed a three-fold decrease in Cx43 expression in COCs expressing the antisense RNA for Cx43. Injection of cumulus cells with Lucifer yellow demonstrated further that the resulting lower amount of Cx43 in infected COCs is associated with a two-fold decrease in the extent of coupling between cumulus cells. In addition, oocyte maturation was decreased by 50% in the infected COC cultures. These results indicate that Cx43-mediated communication between cumulus cells plays a crucial role in maturation of bovine oocytes.

Characterization of human gene expression changes after olive oil ingestion: an exploratory approach

Olive oil consumption is protective against risk factors for cardiovascular and cancer diseases. A nutrigenomic approach was performed to assess whether changes in gene expression could occur in human peripheral blood mononuclear cells after oli ve oil ingestion at postprandial state. Six healthy male volunteers ingested, at fasting state, 50 ml of olive oil. Prior to intervention a 1-week washout period with a controlled diet and sunflower oil as the only source of fat was followed. During the 3 days before and on the intervention day, a very low-phenolic compound diet was followed. At baseline (0 h) and at post-ingestion (6 h), total RNA was isolated and gene expression (29,082 genes) was evaluated by microarray. From microarray data, nutrient-gene interactions were observed in genes related to metabolism, cellular processes, cancer, and atherosclerosis (e.g. USP48 by 2.16; OGT by 1.68-fold change) and associated processes such as inflammation (e.g. AKAP13 by 2.30; IL-10 by 1.66-fold change) and DNA damage (e.g. DCLRE1C by 1.47; POLK by 1.44- fold change). When results obtained by microarray were verified by qRT-PCR in nine genes, full concordance was achieved only in the case of up-regulated genes. Changes were observed at a real-life dose of olive oil, as it is daily consumed in some Mediterranean areas. Our results support the hypothesis that postprandial protective changes related to olive oil consumption could be mediated through gene expression changes.

Genetic vulnerability factor for schizophrenia: association with glutamate cysteine ligase modifier gene and abnormal enzyme activity

Background: We previously reported in schizophrenia patients a decreased level of glutathione ([GSH]), the principal non-protein antioxidant and redox regulator, both in cerebrospinal-fluid and prefrontal cortex. To identify possible genetic causation, we studied genes involved in GSH metabolism. Methods: Genotyping: mass spectrometry analysis of polymerase chain reaction (PCR) amplified DNA fragments purified from peripheral blood. Gene expression: real-time PCR of total RNA isolated from fibroblast cultures derived from skin of patients (DSM-IV) and healthy controls (DIGS). Results: Case-control association study of single nucleotide polymorphisms (SNP) from the GSH key synthesizing enzyme glutamate-cysteine-ligase (GCL) modifier subunit (GCLM) was performed in two populations: Swiss (patients/controls: 40/31) and Danish (349/348). We found a strong association of SNP rs2301022 in GCLM gene (Danish: c2=3.2; P=0.001 after correction for multiple testing). Evidence for GCLM as a risk factor was confirmed in linkage study of NIMH families. Moreover, we observed a decrease in GCLM mRNA levels in patient fibroblasts, consistently with the association study. Interestingly, Dalton and collaborators reported in GCLM knock-out mice an increased feedback inhibition of GCL activity, resulting in 60% decrease of brain [GSH], a situation analogous to patients. These mice also exhibited an increased sensitivity to oxidative stress. Similarly, under oxidative stress conditions, GCL enzymatic activity was also decreased in patient fibroblasts. Conclusions: These results at the genetic and functional levels, combined with observations that GSH deficient models reveal morphological, electrophysiological, and behavioral anomalies analogous to those observed in patients, suggest that GCLM allelic variant is a vulnerability factor for schizophrenia.

Characterization and functional identification of a novel plant extradiol 4,5-dioxygenase involved in betalain pigment biosynthesis in Portulaca Grandiflora

RESUME Les bétalaïnes sont des pigments chromo-alcaloïdes violets et jaunes présents dans les plantes appartenant à l'ordre des Caryophyllales et dans les champignons des genres Amanita et Hygrocybe. Leur courte voie de biosynthèse est élucidée chimiquement depuis de nombreuses années, mais les enzymes impliquées dans cette biosynthèse chez les plantes ne sont toujours pas caractérisées. L'enzyme de la DOPA-dioxygénase d' Amanita muscaria a été identifiée (Girod et Zryd, 1991a), mais de nombreuses tentatives d'isolation d'un homologue chez les plantes ont échoué. Afin d'isoler les gènes spécifiques des bétalaïnes chez les plantes, nous avons construit des banques soustraites d'ADNc à partir d'ARN total de pétales immatures de Portulaca grandiflora (Pg) de génotypes jaunes et blancs, respectivement violets et blancs. Les clones couleur- spécifiques ont été détectés en premier par analyse Northem du RNA de pétales blancs et colorés. Les candidats positifs ont alors été soumis à une analyse de transcription au niveau des tiges colorées, vertes et des feuilles, afin d'établir leur expression spécifique. Deux ARNs messagers complets ont une expression corrélée avec l'accumulation des bétalaïnes dans les tissus. Le premier de ces clones, A.16, code pour une oxydase de l'acyl-Coenzyme A (ACX) putative, mais le domaine de liaison du FAD essentiel pour l'activité d'ACX est absent. Toutes nos tentatives pour démontrer sa fonction ont échoué. Le rôle de cette protéine dans la voie de synthèse des bétalaïnes reste inconnu. Le deuxième de ces clones spécifique aux bétalaïnes, L.6 (isolé par Zaiko, 2000), a été renommé DODA en raison de son homologie avec le domaine LigB (pfam02900) d'une 4,5-dioxygénase extradiol bactérienne. DODA a été identifié in silico comme une dioxygénase extradiol en raison de la conservation stricte, au niveau de sa séquence peptidique, des résidus catalytiques de LigB et de ceux liant le cofacteur fer. Une analyse de transfert Southem a montré que ce gène est unique dans Pg. L'expression transitoire de DODA par transformation biolistique dans des pétales blancs de Pg a produit des taches violettes ou jaunes dans des cellules transformées. Une analyse HPLC de ces taches a démontré leur identité avec les bétalaïnes présentes naturellement dans les pétales violets et jaunes de Pg, confirmant ainsi la complémentation par le gène Pg DODA de l'allèle récessif cc présent dans les pétales blancs de Pg. Des homologues de DODA (DOPA-dioxygénase) ont été identifiés dans de nombreuses espèces de plantes, y compris dans celles sans bétalaïne. L'alignement de ces homologues a permis l'identification d'un motif spécifique aux bétalaïnes à côté d'une histidine catalytique conservée. Ce motif [H-P-(S,A)-(N,D)-x-T-P] remplace le motif [H-N-L-R] conservé dans les plantes sans bétalaïne et le motif [H-N-L-x] présent dans tous les homologues bactériens et archaebactériens. Une modélisation tridimensionnelle préliminaire du site actif de Pg DODA et de son homologue dans la mousse Physcomitrella patens a montré l'importance de ce motif spécifique aux bétalaïnes pour l'accessibilité du substrat au site actif. L'analyse phylogénétique de DODA a confirmé l'évolution séparée de cette protéine chez les plantes à bétalaïnes par comparaison avec celle des plantes sans bétalaïne. Nous avons donc conclu que les bétalaïnes sont apparues par modification de l'affinité pour un substrat d'enzymes similaires à DODA, chez un ancêtre unique des Caryophyllales qui a perdu toute capacité de biosynthèse des anthocyanes. Finalement, Pg DODA n'a aucune similarité avec la protéine DODA d' Amanita muscaria, bien que celle-ci complémente aussi la pigmentation des pétales blancs de Pg. La biosynthèse des bétalaïnes est un exemple remarquable de convergence évolutive biochimique indépendante entre espèces de règnes différents. ABSTRACT Betalains are violet and yellow chromo-alkaloid pigments present in plants belonging to the order Caryophyllales and also in the fungal genera Amanita and Hygrocybe. Their short biosynthetic pathway is chemically well understood since many years, but enzymes involved in the plant pathway are still uncharacterized. The DOPA-dioxygenase from Amanita muscaria was identified (Girod and Zryd, 1991a), but numerous attempts to identify a plant homologue to the corresponding gene, failed. In order to isolate betalain-specific genes in plants, subtractive cDNA libraries were built with total RNA from white and yellow and respectively, violet immature petals from Portulaca grandiflora (Pg) genotypes. Colour-specific clones were first detected by Northern blot analysis using RNA from white and coloured petals. Positive candidates were submitted to further transcription analysis in coloured, green stems and leaves in order to assess their specific expression. Two full-length mRNAs showed a correlated expression with betalain accumulation in tissues. One of them, A.16, encodes a putative acyl-Coenzyme A oxidase (ACX), but missing the FAD binding domain essential for the ACX activity. Thus, all attempts to demonstrate its function failed. The role of this protein in the betalain biosynthesis pathway, if any, is still unknown. The second betalain-specific mRNA, L.6 (isolated by Zaiko, 2000) shows a homology with a LigB domain (pfam02900) from a bacterial extradiol 4,5-dioxygenase. It was then renamed DODA (DOPA-dioxygenase). DODA was identified in silico as a highly conserved extradiol dioxygenase due to the strict conservation of its peptidic sequence with LigB catalytic residues and iron-binding cofactor residues. Southern blot analysis showed that this gene is a single copy-gene in Pg. Transient expression of DODA protein through biolistic transformation of Pg white petals produced violet or yellow spots in individual cells. HPLC analysis of these spots showed an identity with betalain pigments present naturally in yellow and violet Pg petals, thus confirming the complementation of the recessive cc allele present in Pg white petals by Pg DODA gene. DODA homologues were identified in numerous plant species including those without betalain. Alignment of these homologues allowed the identification of a betalain-specific pattern beside a highly conserved catalytic histidine. This [H-P-(S,A)-(N,D)-x-T-P] pattern replaces a [H-N-L-R] pattern strictly conserved in non-betalain plants and a [H-N-L-x] pattern present in all bacterial and archaebacterial homologues. Preliminary three-dimensional modeling of the active site of Pg DODA and its Physcomitrella patens moss homologue revealed the importance of this betalain-specific pattern for the substrate accessibility to the DODA active site. DODA phylogenetic analysis confirmed the separate evolution of this protein in betalain-producing plants. We conclude that betalain pigments appeared in a unique ancestor of the Caryophyllales order in which anthocyanin biosynthetic pathway was impaired, by a modification of enzymes of the DODA family for substrate affinity. The Pg DODA protein has no sequence similarity with Amanita muscaria DODA, despite the fact that they both complement Pg white petals for their pigmentation. Betalain biosynthesis is an interesting example of independent biochemical evolutionary convergence between species from different kingdoms.

Hypercaloric cafeteria-like diet induced UCP3 gene expression in skeletal muscle is impaired by hypothyroidism

The uncoupling protein UCP3 belongs to a family of mitochondrial carriers located in the inner mitochondrial membrane of certain cell types. It is expressed almost exclusively at high levels in skeletal muscle and its physiological role has not been fully determined in this tissue. In the present study we have addressed the possible interaction between a hypercaloric diet and thyroid hormone (T3), which are strong stimulators of UCP3 gene expression in skeletal muscle. Male Wistar rats weighing 180 ± 20 g were rendered hypothyroid by thyroidectomy and the addition of methimazole (0.05%; w/v) to drinking water after surgery. The rats were fed a hypercaloric cafeteria diet (68% carbohydrates, 13% protein and 18% lipids) for 10 days and sacrificed by decapitation. Subsequently, the gastrocnemius muscle was dissected, total RNA was isolated with Trizol™ and UCP3 gene expression was determined by Northern blotting using a specific probe. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls post-test. Skeletal muscle UCP3 gene expression was decreased by 60% in hypothyroid rats and UCP3 mRNA expression was increased 70% in euthyroid cafeteria-fed rats compared to euthyroid chow-fed animals, confirming previous studies. Interestingly, the cafeteria diet was unable to stimulate UCP3 gene expression in hypothyroid animals (40% lower as compared to euthyroid cafeteria-fed animals). The results show that a hypercaloric diet is a strong stimulator of UCP3 gene expression in skeletal muscle and requires T3 for an adequate action.

Tumor growth reduction is regulated at the gene level in Walker 256 tumor-bearing rats supplemented with fish oil rich in EPA and DHA

We investigated the effect of fish oil (FO) supplementation on tumor growth, cyclooxygenase 2 (COX-2), peroxisome proliferator-activated receptor gamma (PPARγ), and RelA gene and protein expression in Walker 256 tumor-bearing rats. Male Wistar rats (70 days old) were fed with regular chow (group W) or chow supplemented with 1 g/kg body weight FO daily (group WFO) until they reached 100 days of age. Both groups were then inoculated with a suspension of Walker 256 ascitic tumor cells (3×107 cells/mL). After 14 days the rats were killed, total RNA was isolated from the tumor tissue, and relative mRNA expression was measured using the 2-ΔΔCT method. FO significantly decreased tumor growth (W=13.18±1.58 vsWFO=5.40±0.88 g, P<0.05). FO supplementation also resulted in a significant decrease in COX-2 (W=100.1±1.62 vsWFO=59.39±5.53, P<0.001) and PPARγ (W=100.4±1.04vs WFO=88.22±1.46, P<0.05) protein expression. Relative mRNA expression was W=1.06±0.022 vsWFO=0.31±0.04 (P<0.001) for COX-2, W=1.08±0.02vs WFO=0.52±0.08 (P<0.001) for PPARγ, and W=1.04±0.02 vs WFO=0.82±0.04 (P<0.05) for RelA. FO reduced tumor growth by attenuating inflammatory gene expression associated with carcinogenesis.

Longitudinal selenium status in healthy British adults: assessment using biochemical and molecular biomarkers

Human selenium (Se) requirements are currently based on biochemical markers of Se status. In rats, tissue glutathione peroxidase-1 (Gpx1) mRNA levels can be used effectively to determine Se requirements; blood Gpx1 mRNA levels decrease in Se-deficient rats, so molecular biology-based markers have potential for human nutrition assessment. To study the efficacy of molecular biology markers for assessing Se status in humans, we conducted a longitudinal study on 39 subjects (age 45 +/- 11) in Reading, UK. Diet diaries (5 day) and blood were obtained from each subject at 2, 8, 17 and 23 weeks, and plasma Se, glutathione peroxidase (Gpx3) enzyme activity, and selenoprotein mRNA levels were determined. There were no significant longitudinal effects on Se biomarkers. Se intake averaged 48 +/- 14 mu g/d. Plasma Se concentrations averaged 1.13 +/- 0.16 mu mol/l. Plasma Se v. energy-corrected Se intake (ng Se/kJ/d) was significantly correlated, but neither Gpx3 activity v. Se intake (ng Se/kJ/d) nor Gpx3 activity v. plasma Se was significantly correlated. Collectively, this indicates that subjects were on the plateaus of the response curves. Selenoprotein mRNAs were quantitated in total RNA isolated from whole blood, but mRNA levels for Gpx1, selenoprotein H, and selenoprotein W (all highly regulated by Se in rodents), as well selenoprotein P, Gpx3, and phospholipid hydroperoxide glutathione peroxidase were also not significantly correlated with plasma Se. Thus selenoprotein molecular biomarkers, as well as traditional biochemical markers, are unable to further distinguish differences in Se status in these Se replete subjects. The efficacy of molecular biomarkers to detect Se deficiency needs to be tested in Se-deficient populations.

Differential expression of apoptosis-related genes from death receptor pathway in chronic myeloproliferative diseases

Background Chronic myeloproliferative disorders (MPDs) are clonal haematopoietic stem cell malignancies characterised by an accumulation of mature myeloid cells in bone marrow and peripheral blood. Deregulation of the apoptotic machinery may be associated with MPD physiopathology. Aims To evaluate expression of death receptors` family members, mononuclear cell apoptosis resistance, and JAK2 allele burden. Subjects and Methods Bone marrow haematopoietic progenitor CD34 cells were separated using the Ficoll-hypaque protocol followed by the Miltenyi CD34 isolation kit, and peripheral blood leukocytes were separated by the Haes-Steril method. Total RNA was extracted by the Trizol method, the High Capacity Kit was used to synthesise cDNA, and real-time PCR was performed using SybrGreen in ABIPrism 7500 equipment. The results of gene expression quantification are given as 2(-Delta Delta Ct). The JAK2 V617F mutation was detected by real-time allelic discrimination PCR assay. Peripheral blood mononuclear cells (PBMCs) were isolated by the Ficoll-hypaque protocol and cultured in the presence of apoptosis inducers. Results In CD34 cells, there was mRNA overexpression for fas, faim and c-flip in polycythaemia vera (PV), essential thrombocythaemia (ET) and primary myelofibrosis (PMF), as well as fasl in PMF, and dr4 levels were increased in ET. In leukocytes, fas, c-flip and trail levels were increased in PV, and dr5 expression was decreased in ET. There was an association between dr5 and fasl expression and JAK2V617F mutation. PBMCs from patients with PV, ET or PMF showed resistance to apoptosis inducers. Conclusions The results indicate deregulation of apoptosis gene expression, which may be associated with MPD pathogenesis leading to accumulation of myeloid cells in MPDs.

Expressão gênica dos receptores toll-símele e sua relação com citocinas potencialmente envolvidas em lesão de reperfusão durante a fase inicial do transplante pulmonar em humanos

Introdução: Imunidade inata é a primeira linha de defesa do hospedeiro contra microorganismos invasores, a qual é mediada por moléculas específicas que reconhecem patógenos, chamadas receptores toll-símile (TLRs). Os TLRs são também capazes de reconhecer ligantes endógenos, tais como conteúdos de células necróticas e proteínas de choque térmico (HSP), resultando na produção de citocinas e ativação do sistema imune adquirido. A função exata dos TLRs ainda é pouco entendida em transplante de órgãos. No entanto, tem sido sugerido que eles podem estar envolvidos na rejeição aguda ou crônica e atuar na resposta do enxerto a lesão por isquemia e reperfusão. Objetivo: Examinar as alterações na expressão gênica dos TLRs durante a fase inicial do transplante pulmonar em humanos e sua relação com citocinas potencialmente envolvidas na lesão por isquemia e reperfusão em transplante de órgãos. Métodos: Foram analisadas biópsias pulmonares de 14 pacientes submetidos a transplante pulmonar (LTx). Estas amostras foram coletadas no final do período de isquemia fria (TIF, n=14), no final do período de isquemia quente (TIQ, n=13),1 hora (n=12) e 2 horas (n=8) após a reperfusão do enxerto. RNA total foi isolado a partir de tecido pulmonar e os níveis de RNA mensageiro (mRNA) dos TLRs (1-10) bem como citocinas (IL-8, IL-6, IL-10, IFN-γ, IL-1β) e proteína de choque térmico 70 (HSP70) foram medidos por reação em cadeia pela polimerase em tempo real. Resultados: Foi detectada a expressão de mRNA de todos TLRs em tecido pulmonar. Nas amostras no TIF, os níveis de mRNA dos TLRs apresentaram-se com diferentes expressões gênicas. Os níveis de expressão dos TLRs, com exceção para o TLR3, estavam altamente correlacionados entre si no TIF e com os níveis de mRNA de IFN-γ, IL-10 e IL-1β e menos significativamente com os níveis de IL-6 e IL-8. Houve diminuição dos níveis de mRNA na grande maioria dos TLRs após reperfusão, o que foi diferente para a maioria das citocinas e HSP70, que apresentaram tendência a aumentar após transplante. A expressão gênica de TLR4 apresentou-se correlacionada com os níveis de IL-8 e IL-1β antes e após transplante (P<0.05). Pulmões de doadores que foram intubados por períodos acima de 72 horas (n=5) apresentaram níveis mais elevados de TLR2 e TLR10 (P<0.05). Conclusão: Pela primeira vez, foi demonstrado que a expressão dos TLRs altera-se durante o período de isquemia e reperfusão em transplante pulmonar em humanos. O tempo de intubação dos doadores pulmonares pode influenciar a expressão de receptores Toll-símile específicos. A correlação entre TLR4 e IL-8/IL-1β sugere que os TLRs pulmonares podem ter alguma função na resposta precoce do enxerto.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

NtWBC1, an ABC transporter gene specifically expressed in tobacco reproductive organs

To identify genes specifically or predominantly expressed in the stigmas/styles and to establish their possible function in the reproductive process of plants, a tobacco stigma/style cDNA library was constructed and differentially screened, resulting in the isolation of several cDNA clones. The molecular characterization of one of these clones is described here. After sequencing the cDNA and the isolated genomic clone, it was determined that the corresponding gene encodes a protein containing an ATP-binding cassette, characteristic of ABC transporters. This gene, designated as NtWBC1 (Nicotiana tabacum ABC transporter of the White-Brown Complex subfamily), encodes a protein that contains the typical structure of the 'half-transporters' of the White subfamily. To establish the spatial expression pattern of the NtWBC1 gene, northern blot and real-time RT-PCR analyses with total RNA from roots, stems, leaves, sepals, petals, stamens, stigmas/styles, ovaries, and seeds were performed. The result revealed a transcript of 2.5 kb present at high levels in stigmas and styles and a smaller transcript (2.3 kb) present at a lower level in stamens. NtWBC1 expression is developmentally regulated in stigmas/styles, with mRNA accumulation increasing toward anthesis. In situ hybridization experiments demonstrated that NtWBC1 is expressed in the stigmatic secretory zone and in anthers, at the stomium region and at the vascular bundle. NtWBC1 is the first ABC transporter gene with specific expression in plant reproductive organs to be identified and its expression pattern suggests important role(s) in the reproductive process.