Identification of small RNAs in Pseudomonas species

Summary: Bacterial small RNAs (sRNAs) are transcripts most of which have regulatory functions. Sequence and secondary structure elements enable numerous sRNAs to interact with mRNAs or with regulatory proteins resulting in diverse regulatory effects on virulence, iron storage, organization of cell envelope proteins or stress response. sRNAs having high affinity for RsmA-like RNA-binding proteins are important for posttranscriptional regulation in various Gram-negative bacteria. In Pseudomonas spp., the GacS/GacA two component system positively controls the production of such sRNAs. They titrate RsmA-like proteins and thus overcome translational repression due to these proteins. As a consequence, secondary metabolites can be produced that are implicated in the biocontrol capacity of P. fluorescens or in the virulence of P. aeruginosa. A genome-wide search carried out in P. aeruginosa PAO1 and in closely related Pseudomonas spp. resulted in the identification of 15 genes coding for sRNAs. Eight of these are novel, the remaining seven have previously been observed. Among them, the 1698 sRNA gene was expressed under GacA control, whereas the transcription of 1887 sRNA gene was transcribed under the control of the anaerobic regulator Anr in an oxygen-limited environment. Overexpression of 1698 sRNA in P. fluorescens strain CHAO did not affect the expression of the GacA-regulated hcnA gene (first gene of the operon coding for HCN synthase), indicating that 1698 sRNA is probably not part of the secondary metabolite regulation pathway. The expression of 1698 sRNA was positively regulated by RpoS in both P. aeruginosa PAO 1 and P. ,fluorescens CHAO and appeared to be modulated temporarily by oxidative stress conditions. However, the effect of 1698 sRNA on oxidative stress survival has not yet been established. Hfq protein interacted with 1698 sRNA in vitro and improved 1698 sRNA expression in vivo in P. aeruginosa. In P. fluorescens, GacA and Hfq were both required for expression of rpoS and GacA showed a positively control on the hfq expression; therefore, at least in this organism, GacA control of 1698 sRNA expression may act indirectly via Hfq and RpoS. Different methods were employed to find abase-pairing target for 1698 sRNA. In a proteomic analysis carried out in P. aeruginosa, positive regulation by 1698 sRNA was observed for Soda, the iron-associated superoxide dismutase, an enzyme involved in oxidative stress resistance. A sequence complementary with 1698 sRNA was predicted to be located in the 5' leader of soda mRNA. However, base-pairing between soda mRNA and 1698 sRNA remains to be proven. In conclusion, this work has revealed eight novel sRNAs and novel functions of two sRNAs in Pseudomonas spp. Résumé Les petits ARNs non-codants (sRNAs) produits par les bactéries sont des transcrits ayant pour la plupart des activités régulatrices importantes. Leurs séquences nucléotidiques ainsi que leurs structures secondaires permettent aux sRNAs d'interagir soit avec des RNA messagers (mRNAs), de sorte à modifier l'expression des protéines pour lesquelles ils codent, soit avec des protéines régulatrices liant des rnRNAs, ce qui a pour effet de modifier l'expression de ces mRNAs. Des sRNAs sont impliqués dans diverses voies de régulation, telles que celles qui régissent la virulence, le stockage du fer, l'organisation des protéines de l'enveloppe bactérienne ou la réponse au stress. Chez les Pseudomonas spp., le système à deux composantes GacS/GacA contrôle la production de métabolites secondaires. Ceux-ci sont engagés dans l'établissement du biocontrôle, chez P. fluorescens, ou. de la virulence, chez P. aeruginosa. La régulation génique dirigée par le système GacS/GacA fait intervenir les sRNAs du type RsmZ, capables de contrecarrer l'action au niveau traductionnel exercée par les protéines régulatrices du type RsmA. Une recherche au niveau du génome a été menée chez P. aeruginosa PAO1 de même que chez des espèces qui lui sont étroitement apparentées, débouchant sur la mise en évidence de 15 gènes codant pour des sRNAs. Parmi ceux-ci, huit ont été découverts pour la première fois et sept confirment des travaux publiés. L'expression du gène du sRNAs 1698 s'avère être régulée par GacA, vraisemblablement de manière indirecte. La transcription du gène du sRNA 1887 montre une dépendance envers Anr, régulateur de l'anaérobiose, et envers une carence en oxygène. La surexpression du sRNA 1698 chez P. fluorescens CHAO n'affecte pas l'expression de hcnA, un gène du régulon GacA, laissant supposer que le sRNA n'intervient pas dans la régulation des métabolites secondaires. Chez P. aeruginosa PAOI et chez P. fluorescens CHAO, RpoS, le facteur sigma du stress, est nécessaire à l'expression du sRNA 1698, et la concentration de ce dernier est modulée par des conditions de stress oxydatif. Toutefois, un effet du sRNA 1698 quant à la survie suite au stress oxydatif n'a pas été établi. Par ailleurs, l'interaction entre le sRNA 1698 et Hfq, la protéine chaperone de RNAs, in vitro ainsi qu'un rôle positif de Hfq pour l'expression du sRNA 1698 in vivo ont été démontrés chez P. aeruginosa. L'induction de l'expression par GacA de rpoS et de hfq a été confirmée chez P. fluorescens CHAO, suggérant que la régulation par GacA du sRNA 1698 pourrait se faire par l'intermédiaire de RpoS et Hfq. Diverses méthodes ont été employées pour identifier un transcrit qui puisse être apparié par le sRNA 1698. Une analyse de protéome chez P. aeruginosa montre que l'expression de Soda, la superoxyde dismutase associée au fer, est positivement régulée par le sRNA 1698. Soda est une enzyme impliquée dans la résistance au stress oxydatif. Une séquence de complémentarité avec le sRNA 1698 a bien été prédite sur le leader 5' du mRNA de soda. Cependant, l'appariement entre le sRNA et son transcrit cible est encore à prouver. En conclusion, ce travail a dévoilé huit nouveaux sRNAs et de nouvelles fonctions pour deux sRNAs chez les Pseudomonas.

Granular layer in the periplasmic space of gram-positive bacteria and fine structures of Enterococcus gallinarum and Streptococcus gordonii septa revealed by cryo-electron microscopy of vitreous sections.

High-resolution structural information on optimally preserved bacterial cells can be obtained with cryo-electron microscopy of vitreous sections. With the help of this technique, the existence of a periplasmic space between the plasma membrane and the thick peptidoglycan layer of the gram-positive bacteria Bacillus subtilis and Staphylococcus aureus was recently shown. This raises questions about the mode of polymerization of peptidoglycan. In the present study, we report the structure of the cell envelope of three gram-positive bacteria (B. subtilis, Streptococcus gordonii, and Enterococcus gallinarum). In the three cases, a previously undescribed granular layer adjacent to the plasma membrane is found in the periplasmic space. In order to better understand how nascent peptidoglycan is incorporated into the mature peptidoglycan, we investigated cellular regions known to represent the sites of cell wall production. Each of these sites possesses a specific structure. We propose a hypothetic model of peptidoglycan polymerization that accommodates these differences: peptidoglycan precursors could be exported from the cytoplasm to the periplasmic space, where they could diffuse until they would interact with the interface between the granular layer and the thick peptidoglycan layer. They could then polymerize with mature peptidoglycan. We report cytoplasmic structures at the E. gallinarum septum that could be interpreted as cytoskeletal elements driving cell division (FtsZ ring). Although immunoelectron microscopy and fluorescence microscopy studies have demonstrated the septal and cytoplasmic localization of FtsZ, direct visualization of in situ FtsZ filaments has not been obtained in any electron microscopy study of fixed and dehydrated bacteria.

A new factor stimulating peptidoglycan hydrolysis to separate daughter cells in Caulobacter crescentus.

Cell division in Gram-negative bacteria involves the co-ordinated invagination of the three cell envelope layers to form two new daughter cell poles. This complex process starts with the polymerization of the tubulin-like protein FtsZ into a Z-ring at mid-cell, which drives cytokinesis and recruits numerous other proteins to the division site. These proteins are involved in Z-ring constriction, inner- and outer-membrane invagination, peptidoglycan remodelling and daughter cell separation. Three papers in this issue of Molecular Microbiology, from the teams of Lucy Shapiro, Martin Thanbichler and Christine Jacobs-Wagner, describe a novel protein, called DipM for Division Involved Protein with LysM domains, that is required for cell division in Caulobacter crescentus. DipM localizes to the mid-cell during cell division, where it is necessary for the hydrolysis of the septal peptidoglycan to remodel the cell wall. Loss of DipM results in severe defects in cell envelope constriction, which is deleterious under fast-growth conditions. State-of-the-art microscopy experiments reveal that the peptidoglycan is thicker and that the cell wall is incorrectly organized in DipM-depleted cells compared with wild-type cells, demonstrating that DipM is essential for reorganizing the cell wall at the division site, for envelope invagination and cell separation in Caulobacter.

Practical considerations for conducting ecotoxicity test methods with manufactured nanomaterials: what have we learnt so far?

This review paper reports the consensus of a technical workshop hosted by the European network, NanoImpactNet (NIN). The workshop aimed to review the collective experience of working at the bench with manufactured nanomaterials (MNMs), and to recommend modifications to existing experimental methods and OECD protocols. Current procedures for cleaning glassware are appropriate for most MNMs, although interference with electrodes may occur. Maintaining exposure is more difficult with MNMs compared to conventional chemicals. A metal salt control is recommended for experiments with metallic MNMs that may release free metal ions. Dispersing agents should be avoided, but if they must be used, then natural or synthetic dispersing agents are possible, and dispersion controls essential. Time constraints and technology gaps indicate that full characterisation of test media during ecotoxicity tests is currently not practical. Details of electron microscopy, dark-field microscopy, a range of spectroscopic methods (EDX, XRD, XANES, EXAFS), light scattering techniques (DLS, SLS) and chromatography are discussed. The development of user-friendly software to predict particle behaviour in test media according to DLVO theory is in progress, and simple optical methods are available to estimate the settling behaviour of suspensions during experiments. However, for soil matrices such simple approaches may not be applicable. Alternatively, a Critical Body Residue approach may be taken in which body concentrations in organisms are related to effects, and toxicity thresholds derived. For microbial assays, the cell wall is a formidable barrier to MNMs and end points that rely on the test substance penetrating the cell may be insensitive. Instead assays based on the cell envelope should be developed for MNMs. In algal growth tests, the abiotic factors that promote particle aggregation in the media (e.g. ionic strength) are also important in providing nutrients, and manipulation of the media to control the dispersion may also inhibit growth. Controls to quantify shading effects, and precise details of lighting regimes, shaking or mixing should be reported in algal tests. Photosynthesis may be more sensitive than traditional growth end points for algae and plants. Tests with invertebrates should consider non-chemical toxicity from particle adherence to the organisms. The use of semi-static exposure methods with fish can reduce the logistical issues of waste water disposal and facilitate aspects of animal husbandry relevant to MMNs. There are concerns that the existing bioaccumulation tests are conceptually flawed for MNMs and that new test(s) are required. In vitro testing strategies, as exemplified by genotoxicity assays, can be modified for MNMs, but the risk of false negatives in some assays is highlighted. In conclusion, most protocols will require some modifications and recommendations are made to aid the researcher at the bench. [Authors]

Comparison of different methods for thin section EM analysis of Mycobacterium smegmatis.

Bacteria are generally difficult specimens to prepare for conventional resin section electron microscopy and mycobacteria, with their thick and complex cell envelope layers being especially prone to artefacts. Here we made a systematic comparison of different methods for preparing Mycobacterium smegmatis for thin section electron microscopy analysis. These methods were: (1) conventional preparation by fixatives and epoxy resins at ambient temperature. (2) Tokuyasu cryo-section of chemically fixed bacteria. (3) rapid freezing followed by freeze substitution and embedding in epoxy resin at room temperature or (4) combined with Lowicryl HM20 embedding and ultraviolet (UV) polymerization at low temperature and (5) CEMOVIS, or cryo electron microscopy of vitreous sections. The best preservation of bacteria was obtained with the cryo electron microscopy of vitreous sections method, as expected, especially with respect to the preservation of the cell envelope and lipid bodies. By comparison with cryo electron microscopy of vitreous sections both the conventional and Tokuyasu methods produced different, undesirable artefacts. The two different types of freeze-substitution protocols showed variable preservation of the cell envelope but gave acceptable preservation of the cytoplasm, but not lipid bodies, and bacterial DNA. In conclusion although cryo electron microscopy of vitreous sections must be considered the 'gold standard' among sectioning methods for electron microscopy, because it avoids solvents and stains, the use of optimally prepared freeze substitution also offers some advantages for ultrastructural analysis of bacteria.

The structure of nervous tissue and of Gram-positive bacteria studied by cryo-electron microscopy of vitreous sections

Résumé La structure, ou l'architecture, des êtres vivants définit le cadre dans lequel la physique de la vie s'accomplit. La connaissance de cette structure dans ses moindres détails est un but essentiel de la biologie. Son étude est toutefois entravée par des limitations techniques. Malgré son potentiel théorique, la microscopie électronique n'atteint pas une résolution atomique lorsqu'elle est appliquée ä la matièxe biologique. Cela est dû en grande partie au fait qu'elle contient beaucoup d'eau qui ne résiste pas au vide du microscope. Elle doit donc être déshydratée avant d'être introduite dans un microscope conventionnel. Des artéfacts d'agrégation en découlent inévitablement. La cryo-microscopie électronique des sections vitreuses (CEMOVIS) a ëté développée afin de résoudre cela. Les spécimens sont vitrifiés, c.-à-d. que leur eau est immobilisée sans cristalliser par le froid. Ils sont ensuite coupés en sections ultrafines et celles-ci sont observées à basse température. Les spécimens sont donc observés sous forme hydratée et non fixée; ils sont proches de leur état natif. Durant longtemps, CEMOVIS était très difficile à exécuter mais ce n'est plus le cas. Durant cette thèse, CEMOVIS a été appliqué à différents spécimens. La synapse du système nerveux central a été étudiée. La présence dans la fente synaptique d'une forte densité de molécules organisées de manière périodique a été démontrée. Des particules luminales ont été trouvées dans Ies microtubules cérébraux. Les microtubules ont servi d'objets-test et ont permis de démontrer que des détails moléculaires de l'ordre du nm sont préservés. La compréhension de la structure de l'enveloppe cellulaire des bactéries Grampositives aété améliorée. Nos observations ont abouti à l'élaboration d'un nouveau modèle hypothétique de la synthèse de la paroi. Nous avons aussi focalisé notre attention sur le nucléoïde bactérien et cela a suscité un modèle de la fonction des différents états structuraux du nucléoïde. En conclusion, cette thèse a démontré que CEMOVIS est une excellente méthode poux étudier la structure d'échantillons biologiques à haute résolution. L'étude de la structure de divers aspects des êtres vivants a évoqué des hypothèses quant à la compréhension de leur fonctionnement. Summary The structure, or the architecture, of living beings defines the framework in which the physics of life takes place. Understanding it in its finest details is an essential goal of biology. Its study is however hampered by technical limitations. Despite its theoretical potential, electron microscopy cannot resolve individual atoms in biological matter. This is in great part due to the fact. that it contains a lot of water that cannot stand the vacuum of the microscope. It must therefore be dehydrated before being introduced in a conventional mìcroscope. Aggregation artefacts unavoidably happen. Cryo-electron microscopy of vitreous sections (CEMOVIS) has been developed to solve this problem. Specimens are vitrified, i.e. they are rapidly cooled and their water is immobilised without crystallising by the cold. They are then. sectioned in ultrathin slices, which are observed at low temperatures. Specimens are therefore observed in hydrated and unfixed form; they are close to their native state. For a long time, CEMOVIS was extremely tedious but this is not the case anymore. During this thesis, CEMOVIS was applied to different specimens. Synapse of central nervous system was studied. A high density of periodically-organised molecules was shown in the synaptic cleft. Luminal particles were found in brain microtubules. Microtubules, used as test specimen, permitted to demonstrate that molecular details of the order of nm .are preserved. The understanding of the structure of cell envelope of Gram-positive bacteria was improved. Our observations led to the elaboration of a new hypothetic model of cell wall synthesis. We also focused our attention on bacterial nucleoids and this also gave rise to a functional model of nucleoid structural states. In conclusion, this thesis demonstrated that CEMOVIS is an excellent method for studying the structure of bìologìcal specimens at high resolution. The study of the structure of various aspects of living beings evoked hypothesis for their functioning.

Dual Action of BPC194: A Membrane Active Peptide Killing Bacterial Cells

Membrane active peptides can perturb the lipid bilayer in several ways, such as poration and fusion of the target cell membrane, and thereby efficiently kill bacterial cells. We probe here the mechanistic basis of membrane poration and fusion caused by membrane-active, antimicrobial peptides. We show that the cyclic antimicrobial peptide, BPC194, inhibits growth of Gram-negative bacteria and ruptures the outer and inner membrane at the onset of killing, suggesting that not just poration is taking place at the cell envelope. To simplify the system and to better understand the mechanism of action, we performed Förster resonance energy transfer and cryogenic transmission electron microscopy studies in model membranes and show that the BPC194 causes fusion of vesicles. The fusogenic action is accompanied by leakage as probed by dual-color fluorescence burst analysis at a single liposome level. Atomistic molecular dynamics simulations reveal how the peptides are able to simultaneously perturb the membrane towards porated and fused states. We show that the cyclic antimicrobial peptides trigger both fusion and pore formation and that such large membrane perturbations have a similar mechanistic basis

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

New insights into small molecules inhibitors and protein-protein interactions of VirB8 : a critical conserved component of the type IV secretion system.

Les systèmes bactériens de sécrétion de type IV (T4SS) sont constitués d’un ensemble de 8 à 12 protéines conservées. Ces dernières sont utilisées lors de la translocation de protéines, la translocation de complexes ADN-protéines mais aussi pour le transport de ces derniers au travers de la membrane cellulaire. Les T4SS, en tant que facteurs de virulence pour beaucoup de pathogènes comme Brucella suis, sont donc d’excellents modèles cibles pour le développement de médicaments d’antivirulence. Ces médicaments, en privant le pathogène de son facteur essentiel de virulence : le T4SS, constituent une alternative ou encore une amélioration des traitements antibiotiques utilisés actuellement. VirB8, un facteur d’assemblage conservé dans le T4SS, forme des dimères qui sont importants pour la fonction des T4SS dans ces pathogènes. De par ses interactions multiples, VirB8 est un excellent modèle pour l’analyse des facteurs d’assemblage mais aussi en tant que cible de médicaments qui empêcheraient son interaction avec d’autres protéines et qui, in fine, désarmeraient les bactéries en les privant de leur fonctions essentielles de virulence. À ce jour, nous savons qu’il existe un équilibre monomère-dimère et un processus d’homodimerization de VirB8 dont l’importance est vitale pour la fonctionnement biologique des T4SSs. En se basant sur des essais quantitatifs d’interaction, nous avons identifié (i) des sites potentiels d’interaction avec d’autres protéines VirB du T4SS mais aussi (ii) isolé des petites molécules inhibitrices afin de tester la fonction protéique de VirB8. Afin de déterminer les acides aminés importants pour l’hétérodimérization de VirB8 avec VirB10, nous avons effectué des expériences de mutagenèse aléatoire, de phage display et d’arrimage moléculaire in silico. Ces expériences ont démontré l’importance de trois acides aminés localisés sur le feuillet β : R160, S162, T164 et I165. Ces derniers seraient importants pour l’association de VirB8 avec VirB10 étant donné que leur mutagenèse entraine une diminution de la formation du complexe VirB8-VirB10. L’objectif actuel de notre projet de recherche est de pouvoir mieux comprendre mais aussi d’évaluer le rôle de VirB8 dans l’assemblage du T4SS. Grace à un méthode de criblage adaptée à partir de la structure de VirB8, nous avons pu identifié une petite molécule inhibitrice BAR-068, qui aurait un rôle prometteur dans l’inhibition du T4SS. Nous avons utilisé la spectroscopie par fluorescence, l’essai à deux hybrides, le cross-linking et la cristallographie afin de déterminer le mécanisme d'interaction existant entre VirB8 et BAR-068. Ces travaux pourraient permettre de nombreuses avancées, notamment en termes de compréhension des mécanismes d’inhibition du T4SS. Notre objectif ultime est de pouvoir caractériser la séquence d’évènements essentiels à l’assemblage et au fonctionnement du T4SS. De manière globale, notre projet de recherche permettrait de révéler les grands principes d’assemblage des protéines membranaires, les processus de sécrétion de protéines chez les bactéries mais aussi de proposer une nouvelle stratégie lors du développement de drogues antimicrobiennes.

Inactivation of Escherichia coli by citral

Aims: The aim was to evaluate (i) the resistance of Escherichia coli BJ4 to citral in a buffer system as a function of citral concentration, treatment medium pH, storage time and initial inoculum size, (ii) the role of the sigma factor RpoS on citral resistance of E. coli, (iii) the role of the cell envelope damage in the mechanism of microbial inactivation by citral, and (iii) possible synergistic effects of mild heat treatment and pulsed-electric fields (PEF) treatment combined with citral. Methods and Results: The initial inoculum size greatly affected the efficacy of citral against E. coli cells. Exposure to 200 µl l-1of citral at pH 4.0 for 24 h at 20 ºC caused the inactivation of more than 5 log10 cycles of cells starting at an inoculum size of 106 or 107 CFU ml-1, whereas increasing the cell concentration to 109 CFU ml-1 caused less than 1 log10 cycle of inactivation. E. coli showed higher resistance to citral at pH 4.0 than pH 7.0. The rpoS null mutant strain E. coli BJ4L1 was less resistant to citral than the wild-type strain. Occurrence of sublethal injury to both, the cytoplasmic and outer membranes was demonstrated by adding sodium chloride or bile salts to the recovery media. The majority of sublethally-injured cells by citral required energy and lipid synthesis for repair. A strongly synergistic lethal effect was shown by mild heat treatment combined with citral but the presence of citral during the application of a PEF treatment did not show any advantage. Conclusions: This work confirms that cell envelope damage is an important event in citral inactivation of bacteria, and it describes the key factors on the inactivation of E. coli cells by citral. Significance and Impact of Study: Knowledge about the mechanism of microbial inactivation by citral helps establish successful combined preservation treatments.

Characterization of the Salmonella typhimurium proteome by semi-automated two dimensional HPLC-mass spectrometry: detection of proteins implicated in multiple antibiotic resistance

The proteome of Salmonella enterica serovar Typhimurium was characterized by 2-dimensional HPLC mass spectrometry to provide a platform for subsequent proteomic investigations of low level multiple antibiotic resistance (MAR). Bacteria (2.15 +/- 0.23 x 10(10) cfu; mean +/- s.d.) were harvested from liquid culture and proteins differentially fractionated, on the basis of solubility, into preparations representative of the cytosol, cell envelope and outer membrane proteins (OMPs). These preparations were digested by treatment with trypsin and peptides separated into fractions (n = 20) by strong cation exchange chromatography (SCX). Tryptic peptides in each SCX fraction were further separated by reversed-phase chromatography and detected by mass spectrometry. Peptides were assigned to proteins and consensus rank listings compiled using SEQUEST. A total of 816 +/- 11 individual proteins were identified which included 371 +/- 33, 565 +/- 15 and 262 +/- 5 from the cytosolic, cell envelope and OMP preparations, respectively. A significant correlation was observed (r(2) = 0.62 +/- 0.10; P < 0.0001) between consensus rank position for duplicate cell preparations and an average of 74 +/- 5% of proteins were common to both replicates. A total of 34 outer membrane proteins were detected, 20 of these from the OMP preparation. A range of proteins (n = 20) previously associated with the mar locus in E. coli were also found including the key MAR effectors AcrA, TolC and OmpF.

Sensitive voltammetric sensor for fast detection of mycolic acids present in mycobacteria

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Papel da proteína ZapA na divisão celular e patogenicidade de Xanthomonas citri subsp. citri

Pós-graduação em Ciências Biológicas (Microbiologia Aplicada) - IBRC

Type IV secretion system is not involved in infection process in citrus

The type IV secretion system (T4SS) is used by Gram-negative bacteria to translocate protein and DNA substrates across the cell envelope and into target cells. Xanthomonas citri subsp. citri contains two copies of the T4SS, one in the chromosome and the other is plasmid-encoded. To understand the conditions that induce expression of the T4SS in Xcc, we analyzed, in vitro and in planta, the expression of 18 ORFs from the T4SS and 7 hypothetical flanking genes by RT-qPCR. As a positive control, we also evaluated the expression of 29 ORFs from the type III secretion system (T3SS), since these genes are known to be expressed during plant infection condition, but not necessarily in standard culture medium. From the 29 T3SS genes analyzed by qPCR, only hrpA was downregulated at 72 h after inoculation. All genes associated with the T4SS were downregulated on Citrus leaves 72 h after inoculation. Our results showed that unlike the T3SS, the T4SS is not induced during the infection process.

A novel protein refolding protocol for the solubilization and purification of recombinant peptidoglycan-associated lipoprotein from Xylella fastidiosa overexpressed in Escherichia coil

Xylella fastidiosa is a Gram-negative xylem-limited plant pathogenic bacterium responsible for several economically important crop diseases. Here, we present a novel and efficient protein refolding protocol for the solubilization and purification of recombinant X. fastidiosa peptidoglycan-associated lipoprotein (XfPal). Pal is an outer membrane protein that plays important roles in maintaining the integrity of the cell envelope and in bacterial pathogenicity. Because Pal has a highly hydrophobic N-terminal domain, the heterologous expression studies necessary for structural and functional protein characterization are laborious once the recombinant protein is present in inclusion bodies. Our protocol based on the denaturation of the XfPal-enriched inclusion bodies with 8 M urea followed by buffer-exchange steps via dialysis proved effective for the solubilization and subsequent purification of XfPal, allowing us to obtain a large amount of relatively pure and folded protein. In addition, XfPal was biochemically and functionally characterized. The method for purification reported herein is valuable for further research on the three-dimensional structure and function of Pal and other outer membrane proteins and can contribute to a better understanding of the role of these proteins in bacterial pathogenicity, especially with regard to the plant pathogen X. fastidiosa. (C) 2012 Elsevier Inc. All rights reserved.