956 resultados para BOVINE SEMEN


Relevância:

70.00% 70.00%

Publicador:

Resumo:

Um reprodutor bovino, Bos indicus, com varicocele bilateral detectado por palpação e ultra-sonografia foi acompanhado por um período de 24 meses quanto à biometria testicular, valores espermáticos e concentração de testosterona comparados entre as estações do ano e outros animais da mesma espécie. As alterações morfológicas dos defeitos maiores e menores não variaram entre o touro com a patologia e os demais touros, no entanto, durante o verão o touro com varicocele apresentou maior percentual de defeitos totais se comparado aos demais touros da mesma espécie (49,86%±6,9 e 27,91%±2,9). O animal apresentou maior percentual de defeitos maiores no verão se comparado às outras estações do ano. Os achados de necrópsia confirmaram o diagnóstico clínico. Pode-se concluir que esta patologia, caracterizada por trombose nos vasos do cordão espermático, comprometeu a termoregulação determinando degeneração testicular severa. O aumento das concentrações de testosterona sérica sugerem a diminuição da retenção de esteroides nos testículos pelo plexo pampiniforme, a produção espermática estava anormal.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Semen cryopreservation is still considered suboptimal due to lower fertility when compared to fresh semen. The reasons for the loss of fertility are various and related to irreversible damage caused to the cells during the freeze-thaw process. An alternative to conventional cryopreservation represents the use of chilled bull semen, preventing the damage associated with freezing, thereby guaranteeing greater sperm viability. The aim of this study was to describe the use of cooled bull semen as a strategy to increase the pregnancy for Fixed-Time Artificial Insemination (FTAI) of Nellore (Bos indicus) cows. One ejaculate of a select Nellore bull obtained by electroejaculation was used; the semen sample was fractioned into two aliquots: one diluted in Botu-Bov® extender containing 6.4% glycerol for cryopreservation (BB-F, frozen group) and one diluted in the same extender, free from cryoprotectants and used for cooling (BB-C, cooled semen group). The samples in the BB-C group were chilled to 5°C using an isothermic box and maintained for 24 h prior to use. A total of 349 lactating Nellore cows (70-90 days after birth) were synchronized by the insertion of a progesterone releasing device (1.0 g) and estradiol benzoate (2.0 mg i.m.) on a random day of the estrous cycle (Day 0); FTAI was performed 44-48 h after the removal of the device. The pregnancy rates were 45.71 and 61.49% (P<0.05), respectively, for the cryopreserved or chilled bovine semen groups. In conclusion, the use of bull semen cooled for 24 h represents an alternative to conventionally cryopreserved semen, as determined by the increase the pregnancy per artificial insemination in bovine herds. © 2012 Science Publication.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The success of semen cryopreservation is influenced by several factors, such as freezing curves and cryoprotectants. These two factors are of special interest once they may lead to many important physical-chemical changes resulting in different degrees of damage in spermatozoa structure. This experiment was designed to compare the effect of bull semen cryopreservation using two freezing techniques: conventional (CT cooling rate of -0.55 degrees C min-1 and freezing rate of -19.1 degrees C min-1) and automated (AT cooling rate of -0.23 degrees C min-1 and freezing rate of -15 degrees C min-1), performed with different curves, and with three cryoprotectants (glycerol, ethylene glycol and dimethyl formamide) on bovine sperm motility and integrity of plasma, acrosomal and mitochondrial membranes. These variables were simultaneously evaluated using the fluorescence probes propidium iodide, fluorescein-conjugated Pisum sativum agglutinin and MitoTracker Green FM. The effects of freezing techniques, as well as of different cryoprotectants were analysed by the analysis of variance. The means were compared by Fishers test. There were no significant differences between freezing techniques (P > 0.05). Glycerol showed higher percentages of motility, vigour and integrity of plasma, acrosomal and mitochondrial membranes than other two cryoprotectants (P < 0.05). Ethylene glycol preserved higher motility and integrity of plasma and mitochondrial membranes than dimethyl formamide (P < 0.05). Sperm motility with glycerol was 30.67 +/- 1.41% and 30.50 +/- 1.06%, with ethylene glycol was 21.17 +/- 1.66% and 21.67 +/- 1.13% and with dimethyl formamide was 8.33 +/- 0.65% and 9.17 +/- 0.72% to CT and AT curves, respectively. The percentage of spermatozoa with simultaneously intact plasma membrane, intact acrosome and mitochondrial function (IPIAH) was 14.82 +/- 1.49% (CT) and 15.83 +/- 1.26% (AT) to glycerol, 9.20 +/- 1.31% (CT) and 9.92 +/- 1.29% (AT) to ethylene glycol 4.65 +/- 0.93% (CT) and 5.17 +/- 0.87% (AT) to dimethyl formamide. Glycerol provided the best results, although nearly 85% of spermatozoa showed some degree of injury in their membranes, suggesting that further studies are required to improve the results of cryopreservation of bovine semen.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The objectives of this study were to assess the effects of induced testicular degeneration in Bos taurus indicus (Nellore) bulls on changes in seminal characteristics and fertilizing ability of sperm. Four Nellore bulls (30-36-month-old, 500-550 kg) with good seminal quality (> 80% motile and morphologically normal sperm) had serotal insulation applied for 5 d. Semen was collected by electroejaculation and cryopreserved at a the pre-insulation moment, and 7, 14, and 21 d after insulation was removed. Gross motility, vigor of sperm movement (1-5), acrosome integrity, sperm morphology (phase-contrast microscopy), nuclear vacuoles and abnormal chromatin (Feulgen-stain) were determined after sperm preparations for in vitro fertilization (IVF). Prior to IVF, sperm were separated using a Percoll gradient (45% and 90%). Normal sperm decreased (P < 0.05) 14 and 21 d after insulation was removed. on 14 and 21 d, the incidence of head defects (9.7 +/- 0.6 and 17.0 +/- 0.8, respectively; mean +/- S.E.M) was higher (P < 0.05) in agreement with the incidence of nuclear vauoles (14.0 +/- 5.0 and 12.3 +/- 2.3) and abnormal chromatin (24.4 +/- 7.2 and 30.8 +/- 2.8). Although the frequency of cleaved oocytes decreased only on 21 d (P < 0.05), blastocyst rates were lower (P < 0.05) than pre-insulation on 14 and 21 d. In regression analyses, only nuclear vacuoles, head defects and intact acrosome accounted for differences in cleavage (R(2) = 0.38, 0.48, and 0.30, respectively) and blastocyst rates (R(2) = 0.35, 0.37, and 0.44). Abnormal chromatin was associated only with blastocyst rates (R(2) = 0.35). In conclusion, blastocyst rate was more sensitive than cleavage rate and the assessment of nuclear integrity is recommended to predict the fertilizing ability of bull sperm. (c) 2008 Elsevier B.V. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Foram utilizados 38 tourinhos com idade inicial entre 426 e 462 dias e final entre 751 e 781 dias das raças Nelore, Guzerá, Gir e Caracu, subdivididos em sete grupos genéticos conforme o método de seleção, com o objetivo de comparar o desenvolvimento reprodutivo, avaliado pelas características físicas e morfológicas do sêmen (volume, aspecto, turbilhonamento, motilidade progressiva e vigor, morfologia e concentração espermáticas), em 11 colheitas com intervalos de 29 dias. Os touros dos grupos Nelore seleção (NeS, n=6), Nelore tradicional (NeT, n=9) e Caracu seleção (CaS, n=6), com 415, 430 e 419kg de peso, respectivamente, apresentaram diferenças em todas as características quando comparados com o Nelore controle (NeC, n=4), com 302kg de peso, na segunda colheita, e este foi o único a diferir dos outros seis grupamentos na décima primeira colheita (P<0,05). Foram registradas diferenças na motilidade progressiva média dos espermatozóides na terceira colheita entre o grupamento CaS (68,3%) e o Guzerá tradicional (GuT, n=5) (10,0%), assim como entre o CaS (76,7%) e o NeS (45,0%) na quarta colheita (P<0,05). Não foram registradas diferenças no total de defeitos de espermatozóides nas segunda e última colheitas. Com base na morfologia espermática pode-se concluir que os tourinhos dos grupos genéticos NeT, CaS, Gir Seleção (GiS, n=4), Guzerá Seleção (GuS, n=4), NeC, GuT e NeS alcançaram a maturidade sexual com idades de 547, 532, 578, 544, 547, 572 e 600 dias, e pesos corporais de 430, 440, 389, 420, 336, 451 e 438kg, respectivamente.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Objetivou-se avaliar as características morfológica e funcional do sêmen bovino congelado comparando-se a eficácia de dois diferentes diluidores. O ejaculado de quatro touros foi dividido em duas partes iguais, uma submetida ao diluidor Tris e gema de ovo (A) e outra ao diluidor à base de lecitina de soja (Andromed®) (B). No experimento I, cinco palhetas dos diluidores A e B de cada touro foram descongeladas e avaliadas quanto à motilidade, vigor, concentração, morfologia espermática e teste de termor-resistência lento. Foram feitas, ainda, avaliação da integridade de membranas, por meio da associação das sondas iodeto de propídio, isotiocionato de fluoresceína - Pisum sativum e carbocianina catiônica lipofílica, e avaliação funcional da membrana plasmática com teste hiposmótico. A avaliação da integridade da cromatina foi realizada pelo método de coloração com laranja de acridina. No experimento II, o sêmen com os diferentes diluidores foi utilizado na fecundação in vitro, sendo observadas taxas de clivagem e desenvolvimento embrionário in vitro. em relação aos resultados obtidos, apenas a porcentagem de espermatozoides no sêmen congelado foi discretamente maior com o diluidor A, concluindo-se que o diluidor composto por lecitina de soja pode substituir o composto por Tris e gema de ovo, respeitando-se as variações individuais de cada touro utilizado no presente experimento.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Aiming to determine the relationship between the frequency of testicular shape and the andrological aspects in young Nellore bulls, 18,676 animals were assessed. All andrological examinations were performed between the years 2000 and 2008. Animals were classified as able for breeding, able for breeding in natural mating system, unable for breeding and discarded. The testicular shape was classified as long, fairly long, oval-long, spherical-oval, and spherical. The analysis of Pearson correlations was performed for testicular shape with scrotal circumference, testicular volume, progressive motility, sperm vigor, major defects, minor defects and total defects. Testicles with oval shape prevailed (99.61%). It was obseved that 76.34; 66.34; 64.34; 58.33 and 50.00% of the animals were classified as sound for breeding for shapes long, fairly long, oval-long, spherical-oval, and spherical, respectively. Correlations between testicular shape with scrotal circumference, testicular volume, progressive motility, sperm vigor, major, minor and total defects were 0.26; 0.08; 0.00; 0.11; -0.02; 0.02 and -0.01, respectively. Testicular shape had no influence upon the andrological examination results. Testicles of long shape were prevalent within the population.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)