Genetic polymorphism in an inflammasome component, cervical mycoplasma detection and female infertility in women undergoing in vitro fertilization

The inflammasome is an inducible cytoplasmic structure that is responsible for production and release of biologically active interleukin-1 (IL-1). A polymorphism in the inflammasome component NALP3 has been associated with decreased IL-1 levels and increased occurrence of vaginal Candida infection. We hypothesized that this polymorphism-induced variation would influence susceptibility to infertility. DNA was obtained from 243 women who were undergoing in vitro fertilization (IVF) and tested for a length polymorphism in intron 2 of the gene coding for NALP3 (gene symbol CIAS1). At the conclusion of testing the findings were analyzed in relation to clinical parameters and IVF outcome. The frequency of the 12 unit repeat allele, associated with maximal inflammasome activity, was 62.3% in cases of female infertility vs. 75.6% in cases where only the male partner had a detectable fertility problem (p = 0.0095). Conversely, the frequency of the 7 unit repeat allele was 28.9% in those with a female fertility problem, 17.0% in women with infertile males and 18.4% in idiopathic infertility (p = 0.0124). Among the women who were cervical culture-positive for mycoplasma the frequency of the 7 unit repeat was 53.7% as opposed to 19.5% in those negative for this infection (p < 0.0001). We conclude that the CIAS1 7 unit repeat polymorphism increases the likelihood of mycoplasma infection-associated female infertility. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Effects of eNOS polymorphisms on nitric oxide formation in healthy pregnancy and in pre-eclampsia

Pre-eclampsia (PE) is associated with decreased nitric oxide (NO) formation. However, no previous study has examined whether genetic variations in the endothelial NO synthase (eNOS) affect this alteration. We hypothesized that PE decreases NO formation depending on eNOS polymorphisms. We examined how three eNOS polymorphisms [T-786C, rs2070744; Glu298Asp, rs1799983; 27 bp variable number of tandem repeats (VNTR) in intron 4] affect plasma nitrite concentrations in 205 pregnant women [107 healthy pregnant (HP) and 98 PE]. Genotypes were determined and eNOS haplotypes were inferred using the PHASE 2.1 program. The plasma nitrite concentrations were determined using an ozone-based chemiluminescence assay. The Glu298Asp polymorphism had no effects on the plasma nitrite concentrations. Higher nitrite levels were found in HP women with the CC versus TT genotype for the T-786C polymorphism (277.9 +/- 19.5 versus 140.6 +/- 8.2 nM; P < 0.05). Lower nitrite levels were found in healthy women with the 4a4a versus 4b4b genotype for the VNTR polymorphism (95.1 +/- 3.3 versus 216.1 +/- 16.8 nM; P < 0.05). No effects of genotypes were found in PE women (all P > 0.05). The `C Glu b` haplotype was more frequent in the HP group than in the PE group (20 versus 5; P = 0.0044). This haplotype was associated with higher nitrite concentrations than the other haplotypes in healthy pregnancies (P < 0.05). No differences in nitrite concentrations were found among PE women with different eNOS haplotypes (P > 0.05). These findings indicate that eNOS polymorphisms affect endogenous NO formation in normal pregnancy, but not in PE, and that the `C Glu b` haplotype may protect against the development of PE by increasing endogenous NO formation.

Genetic and environmental risk factors and their interactions for Parkinson's disease in a Chinese population

The interaction between genetic and environmental factors for PD was examined in a Chinese population. It was found that although the intron 2 MAOB (GT)(n) repeat polymorphism was not associated with PID in the population, a relationship might have been masked by the protective effect of tea drinking. In individuals who did not drink tea (<1 cup/day), the possession of short length less than or equal to 178 bp (GT), alleles conferred a borderline significant increased risk for PD (adjusted OR = 1.47; C.l. = 1.03-2. 1). As the extent of tea consumption increased, the association between the less than or equal to178 bp allele and PD disappeared. This result suggests that the MAOB gene may be associated with PD in Chinese if the putative protective effect of tea drinking is taken into account. The significance of this finding is unclear as the study may be limited because of its marginal significance and limited numbers. However, it does demonstrate the importance of considering putative positive and negative environmental risk factors in any examination of genetic risk factors for PD. (C) 2003 Elsevier Science Ltd. All rights reserved.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

MSX1 gene and nonsyndromic oral clefts in a Southern Brazilian population

Nonsyndromic oral clefts (NSOC) are the most common craniofacial birth defects in humans. The etiology of NSOC is complex, involving both genetic and environmental factors. Several genes that play a role in cellular proliferation, differentiation, and apoptosis have been associated with clefting. For example, variations in the homeobox gene family member MSX1, including a CA repeat located within its single intron, may play a role in clefting. The aim of this study was to investigate the association between MSX1CA repeat polymorphism and NSOC in a Southern Brazilian population using a case-parent triad design. We studied 182 nuclear families with NSOC recruited from the Hospital de Clínicas de Porto Alegre in Southern Brazil. The polymorphic region was amplified by the polymerase chain reaction and analyzed by using an automated sequencer. Among the 182 families studied, four different alleles were observed, at frequencies of 0.057 (175 bp), 0.169 (173 bp), 0.096 (171 bp) and 0.67 (169 bp). A transmission disequilibrium test with a family-based association test (FBAT) software program was used for analysis. FBAT analysis showed overtransmission of the 169 bp allele in NSOC (P=0.0005). These results suggest that the CA repeat polymorphism of theMSX1 gene may play a role in risk of NSOC in populations from Southern Brazil.

Reversible phase variation in the phnE gene, which is required for phosphonate metabolism in Escherichia coli K-12

It is known that Escherichia coli K-12 is cryptic (Phn(-)) for utilization of methyl phosphonate (MePn) and that Phn(+) variants can be selected for growth on MePn as the sole P source. Variants arise from deletion via a possible slip strand mechanism of one of three direct 8-bp repeat sequences in phnE, which restores function to a component of a putative ABC type transporter. Here we show that Phn(+) variants are present at the surprisingly high frequency of >10(-2) in K-12 strains. Amplified-fragment length polymorphism analysis was used to monitor instability in phnE in various strains growing under different conditions. This revealed that, once selection for growth on MePn is removed, Phn(+) revertants reappear and accumulate at high levels through reinsertion of the 8-bp repeat element sequence. It appears that, in K-12, phnE contains a high-frequency reversible gene switch, producing phase variation which either allows ("on" form) or blocks ("off" form) MePn utilization. The switch can also block usage of other metabolizable alkyl phosphonates, including the naturally occurring 2-aminoethylphosphonate. All K-12 strains, obtained from collections, appear in the "off" form even when bearing mutations in mutS, mutD, or dnaQ which are known to enhance slip strand events between repetitive sequences. The ability to inactivate the phnE gene appears to be unique to K-12 strains since the B strain is naturally Phn(+) and lacks the inactivating 8-bp insertion in phnE, as do important pathogenic strains for which genome sequences are known and also strains isolated recently from environmental sources.

Associations between LEP, DGAT1 and FABP4 gene polymorphisms and carcass and meat traits in Nelore and crossbred beef cattle

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Copy-choice recombination mediated by DNA polymerase III holoenzyme from Escherichia coli.

Formation of deletions by recombination between short direct repeats is thought to involve either a break-join or a copy-choice process. The key step of the latter is slippage of the replication machinery between the repeats. We report that the main replicase of Escherichia coli, DNA polymerase III holoenzyme, slips between two direct repeats of 27 bp that flank an inverted repeat of approximately equal 300bp. Slippage was detected in vitro, on a single-stranded DNA template, in a primer extension assay. It requires the presence of a short (8 bp) G+C-rich sequence at the base of a hairpin that can form by annealing of the inverted repeats. It is stimulated by (i) high salt concentration, which might stabilize the hairpin, and (ii) two proteins that ensure the processivity of the DNA polymerase III holoenzyme: the single-stranded DNA binding protein and the beta subunit of the polymerase. Slippage is rather efficient under optimal reaction conditions because it can take place on >50% of template molecules. This observation supports the copy-choice model for recombination between short direct repeats.

Effects of dopamine receptor D4 variation on alcohol and tobacco use and on novelty seeking: Multivariate linkage and association analysis

The dopamine D4 receptor gene contains a polymorphic sequence consisting of a variable number of 48-base-pair (bp) repeats, and there have been a number of reports that this polymorphism is associated with variation in novelty seeking or in substance abuse and addictive behaviors. In this study we have assessed the linkage and association of DRD4 genotype with novelty seeking, alcohol use, and smoking in a sample of 377 dizygotic twin pairs and 15 single twins recruited from the Australian Twin Registry (ATR). We found no evidence of linkage or association of the DRD4 locus with any of the phenotypes. We made use of repeated measures for some phenotypes to increase power by multivariate genetic analysis, but allelic effects were still non-significant. Specifically, it has been suggested that the DRD4 7-repeat allele is associated with increased novelty seeking in males but we found no evidence for this, despite considerable power to do so. We conclude that DRD4 variation does not have an effect on use of alcohol and the problems that arise from it, on smoking, or on novelty seeking behavior. (C) 2003 Wiley-Liss, Inc.

The TAF5L gene on chromosome 1q42 is associated with type 1 diabetes in Russian affected patients

Type 1 diabetes (T1D) is a multifactorial autoimmune disease, with strong genetic component. Several susceptibility loci contribute to genetic predisposition to T1D. One of these loci have been mapped to chromosome 1q42 in UK and US joined affected family data sets but needs to be replicated in other populations. In this study, we evaluated sixteen microsatellites located on 1q42 for linkage with T1D in 97 Russian affected sibling pairs. A 2.7-cm region of suggestive linkage to T1D between markers D1S1644 and D1S225 was found by multipoint linkage analysis. The peak of linkage was shown for D1S2847 (P = 0.0005). Transmission disequilibrium test showed significant undertransmission of the 156-bp allele of D1S2847 from parents to diabetic children (28 transmissions vs. 68 nontransmissions, P = 0.043) in Russian affected families. A preferential transmission from parents to diabetic offspring was also shown for the T(-25) and T1362 alleles of the C/T(-25) and C/T1362 dimorphisms, both located at the TAF5L gene, which is situated 103 kb from D1S2847. Together with the A/C744 TAF5L SNP, these markers share common T(-25)/A744/T1362 and C(-25)/C744/T1362 haplotypes associated with higher and lower risk of diabetes (Odds Ratio = 2.15 and 0.62, respectively). Our results suggest that the TAF5L gene, encoding TAF5L-like RNA polymerase II p300/CBP associated factor (PCAF)-associated factor, could represent the susceptibility gene for T1D on chromosome 1q42 in Russian affected patients.

Endothelial Nitric Oxide Synthase Haplotypes Associated with Aura in Patients with Migraine

There is strong evidence implicating nitric oxide (NO) in the pathophysiology of migraine and aura. Therefore, genetic polymorphisms in the endothelial NO synthase (eNOS) gene have been studied as candidate markers for migraine susceptibility. We compared for the first time the distribution of eNOS haplotypes including the three clinically relevant eNOS polymorphisms (T(-786)C in the promoter, rs2070744; Glu298Asp in exon 7, rs1799983; and a 27 bp variable number of tandem repeats in intron 4) and two additional tagging single-nucleotide polymorphisms (rs3918226 and rs743506) in 178 women with migraine (134 without aura and 44 with aura) and 117 healthy controls (control group). Genotypes were determined by TaqMan allele discrimination assay, real-time polymerase chain reaction, and polymerase chain reaction followed by fragment separation by electrophoresis. The GA (rs743506) genotype was more common in the control group than in women with migraine (odds ratio = 0.47, 95% confidence interval [CI] 0.29-0.78, p<0.01). No significant differences were found in allele distributions for the five eNOS polymorphisms. However, the haplotypes including the variants ""C C a Glu G"" and the variants ""C C b Glu G"" were more common in women with migraine with aura than in women with migraine without aura (odds ratio = 30.71, 95% CI = 1.61-586.4 and odds ratio = 17.26, 95% CI = 1.94-153.4, respectively; both p<0.0015625). These findings suggest that these two eNOS haplotypes affect the susceptibility to the presence of aura in patients with migraine.

Heteroplasmy in Hair: Study of Mitochondrial DNA Third Hypervariable Region in Hair and Blood Samples

Mitochondrial DNA (mtDNA) analysis has proved useful for forensic identification especially in cases where nuclear DNA is not available, such as with hair evidence. Heteroplasmy, the presence of more than one type of mtDNA in one individual, is a common situation often reported in the first and second mtDNA hypervariable regions (HV1/HV2), particularly in hair samples. However, there is no data about heteroplasmy frequency in the third mtDNA hypervariable region (HV3). To investigate possible heteroplasmy hotspots, HV3 from hair and blood samples of 100 individuals were sequenced and compared. No point heteroplasmy was observed, but length heteroplasmy was, both in C-stretch and CA repeat. To observe which CA ""alleles"" were present in each tissue, PCR products were cloned and re-sequenced. However, no variation among CA alleles was observed. Regarding forensic practice, we conclude that point heteroplasmy in HV3 is not as frequent as in the HV1/HV2.

Could the Leukocyte X Chromosome Inactivation Pattern Be Extrapolated to Hair Bulbs?

Background: The androgen receptor gene is located on the X chromosome with a polymorphic tract of CAG repeats that is inversely correlated to the receptor`s transactivation activity. A short CAG tract is associated with hyperandrogenic disorders. In women, one of the X chromosomes is inactivated and the X chromosome inactivation (XCI) pattern varies among tissues. Previous studies of hyperandrogenic disorders only evaluated XCI in leukocytes. Objective: To evaluate whether the XCI pattern in leukocytes could be extrapolated to those in hair bulbs. Material: A total of 58 healthy women were used for this study. DNA was extracted from leukocytes (n = 58 women) and pubic (n = 53 women) and scalp hair (n = 21 women). Methods: Hpa II digested and undigested DNA samples underwent fluorescence PCR GeneScan (R) analysis. Results: A significant and positive correlation of XCI was found between leukocytes and hair bulbs. However, individual comparisons showed that 13 and 19% of the women presented a different leukocyte XCI pattern in pubic hair and similar in leukocytes and hair bulbs of normal women indicating that leukocyte DNA is useful for XCI analysis. However, the XCI pattern could vary among tissues from the same subject, indicating that care should be taken when extrapolating individual leukocyte XCI patterns to other tissue. Copyright (C) 2010 S. Karger AG, Basel

Insulin-like growth factor 2 cDNA cloning and ontogeny of gene expression in the liver of the marsupial brushtail possum (Trichosurus vulpecula)

The cDNA sequence for insulin-like growth factor 2 (IGF-2) was determined from the liver of the marsupial brushtail possum (Trichosurus vulpecula) using reverse transcription followed by polymerase chain reaction (RT-PCR) with gene-specific primers. The 359 bp of possum sequence encompassed the mature peptide, 27 bp of the signal peptide, and 125 bp of the E-peptide. Alignment of the deduced amino acid sequence with those from other species indicated that the mature peptide was 71 amino acids in length, 4 amino acids longer than most other mammals. At both the nucleotide and amino acid levels there was a high degree of sequence identity with IGF-2 from other mammalian and nonmammalian species. Amino acid identity ranged from 94.4% with a variant form of human IGF-2 to 80.3% with zebrafinch IGF-2. Northern analysis revealed that radiolabeled possum IGF-2, cDNA hybridized to multiple transcripts in the liver of both adult possums and 150-day-old pouch young and that the overall level of expression was greater in pouch young. Semiquantitative RT-PCR with total RNA from liver samples of pouch young aged 12 to 150 days postpartum and adults confirmed that IGF-2 gene expression was two to three times more abundant in pouch young than in adults but there was no significant change in the level of expression during pouch life. Unlike other mammalian species, in which there is a decline in levels of liver IGF-2 gene expression around the time of birth, levels in the marsupial brushtail possum remain elevated for at least 150 days after birth. This suggests that the decline in liver IGF-2 expression in marsupials and eutherians occurs at a similar stage of development and may reflect a role for this growth factor during the postnatal growth and development of the marsupial, (C) 2001 Academic Press.

Cerebral vasculopathy in children with sickle cell disease A study of genetic modulators of the disease

Sickle cell disease (SCD) is a genetic disorder with recessive transmission, caused by the mutation HBB:c.20A>T. It originates hemoglobin S that forms polymers inside the erythrocyte, upon deoxygenation, deforming it and ultimately leading to premature hemolysis. The disease presents with high heterogeneity of clinical manifestations, the most devastating of which, ischemic stroke, occurs in 11% of patients until 20 years of age. In this study, we tried to identify genetic modifiers of risk and episodes of stroke by studying 66 children with SCD, grouped according to the degree of cerebral vasculopathy (Stroke, Risk and Control). Association studies were performed between the three phenotypic groups and hematological and biochemical parameters of patients, as well as with 23 polymorphic regions in genes related to vascular cell adhesion (VCAM-1, THBS-1 and CD36), vascular tonus (NOS3 and ET-1) and inflammation (TNF-α and HMOX-1). Relevant data was collected from patient’s medical records. Known genetic modulators of SCD (beta-globin cluster haplotype and HBA and BCL11A genotypes) and putative genetic modifiers of cerebral vasculopathy were characterized. Differences in their distribution among groups were assessed. VCAM-1 rs1409419 allele C and NOS3 rs207044 allele C were associated to stroke events, while VCAM-1 rs1409419 allele T was found to be protective. Alleles 4a and 4b of NOS3 27 bp VNTR appeared to be respectively associated to stroke risk and protection. HMOX-1 longer STRs seemed to predispose to stroke. Higher hemoglobin F levels were found in Control group, as a result of Senegal haplotype or of BCL11A rs11886868 allele T, and higher lactate dehydrogenase levels, marker of hemolysis, were found in Risk group. Molecular mechanisms underlying the modifier functions of the relevant genetic variants are discussed.