A rapid and sensitive method for the estimation of individual tRNA pools

A rapid and sensitive method is described to quantitatively compare tRNA pools for individual aminoacids in a single experiment. The procedure comprises of: (i) charging of total tRNA with a mixture of radiolabeled aminoacids, (ii) deacylation of the esterified tRNA with a volatile base and the recovery of the labeled aminoacid, (iii) derivatisation of the aminoacid with phenylisothiocyanate after mixing with excess of nonradioactive aminoacids, (iv) baseline separation of the phenylthiocarbamyl aminoacids by reverse phase high performance liquid chromatography monitored by A254nm and (v) quantitation of the radioactivity in individual aminoacid peaks. The radioactivity in the aminoacid peak corresponds to the quantity of the aminoacylated tRNA. The method has been successfully applied to quantitate the individual tRNA pools in the developing silk glands of Bombyx mori, a functionally adapted tissue which undergoes considerable variations in tRNA content. PSG, posterior silk gland; PITC, phenylisothiocyanate; DMAA, N,N-dimethyl-N-allylamine; APH, algal protein hydrolysate; ptc-, phenylthiocarbamyl; HPLC, high performance liquid chromatography.

5-Methyl-2-Thiouridine in the tRNA of Candida tropicalis and Its Localization in Lysine tRNA

35S incorporation studies showed that Candida tropicalis tRNA contained two thionucleosides, one of which was identified as 5-methyl-2-thiouridine. The other thionucleoside was alkali labile, and it appeared to be an ester. Pulse-chase experiments suggested that the two thionucleosides were structurally related. 5-Methyl-2-thiouridine was present in one of the lysine tRNAs. This is the first report of the presence of this nucleoside in a yeast tRNA.

2-O-methyl-1-methyl adenosine: A new modified nucleoside in ragi (eleusine coracana ) tRNA

A new modified nucleoside 2-²-O-methyl-l-methyl adenosine has been found to be present in the tRNA of (eleusine coracana ) (ragi) seedlings. The sequence of the dinucleotide of which this modified nucleoside is a part suggests its presence in phenylalanine-tRNA. The structural implications of the presence of this new modification are discussed.

Presence of 2-methylthioribosyl-trans-zeatin in Azotobacter vinelandii tRNA.

Hydroxylated cytokinin, 2-methylthio-N6-(4-hydroxy-3-methylbut-2-enyl) adenosine, was found in the tRNA of Azotobacter vinelandii. This cytokinin had the trans configuration, unlike the cis configuration reported for that from other bacteria. Culture-condition-dependent changes in the content of this thiocytokinin and a few other thionucleosides in the tRNA of this bacterium have been observed.

Nucleotide sequence of initiator tRNA from Mycobacterium smegmatis

Abstract is not available.

Mechanism of aminoacylation of tRNA : Influence of spermine on the kinetics of aminoacyl-tRNA synthesis by isoleucyl- and valyl-tRNA synthetases from Mycobacterium smegmatis

Isoleucyl-tRNA synthetase has been purified to homogeneity from Mycobacterium smegmatis. The influence of spermine on the kinetics of valyl-tRNA and isoleucyl-tRNA formation has been investigated by Cleland's method (Cleland, W.W. (1963) Biochim. Biophys. Acta 67, 104–137, 173–187, 188–196). The results suggest that in the presence of spermine and suboptimal concentration of Mg2+, the formation of valyl-tRNA and isoleucyl-tRNA follows a sequential* mechanism. In the presence of an optimal concentration of Mg2+, both valyl-tRNA and isoleucyl-tRNA formation proceeds by a ping-pong mechanism. However, in the presence of spermine and optimal concentrations of Mg2+, valyl-tRNA formation follows the ping-pong mechanism while isoleucyl-tRNA formation follows the sequential mechanism.

A simple method for large-scale preparation of chick embryo tRNA

A simple method for preparing bulk quantities of tRNA from chick embryo has been developed. In this method chick embryos were homogenized in a buffer of pH 4.5, followed by deproteinization with phenol. The aqueous layer was allowed to separate under gravity. The resulting aqueous layer, after two more phenol treatments, was directly passed through a DEAE-cellulose column and the tRNA eluted therefrom with 1 Image NaCl. The tRNA prepared by this method was as active as the one prepared at neutral pH.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Ligand dependent intra and inter subunit communication in human tryptophanyl tRNA synthetase as deduced from the dynamics of structure networks

Homodimeric protein tryptophanyl tRNA synthetase (TrpRS) has a Rossmann fold domain and belongs to the 1c subclass of aminoacyl tRNA synthetases. This enzyme performs the function of acylating the cognate tRNA. This process involves a number of molecules (2 protein subunits, 2 tRNAs and 2 activated Trps) and thus it is difficult to follow the complex steps in this process. Structures of human TrpRS complexed with certain ligands are available. Based on structural and biochemical data, mechanism of activation of Trp has been speculated. However, no structure has yet been solved in the presence of both the tRNA(Trp) and the activated Trp (TrpAMP). In this study, we have modeled the structure of human TrpRS bound to the activated ligand and the cognate tRNA. In addition, we have performed molecular dynamics (MD) simulations on these models as well as other complexes to capture the dynamical process of ligand induced conformational changes. We have analyzed both the local and global changes in the protein conformation from the protein structure network (PSN) of MD snapshots, by a method which was recently developed in our laboratory in the context of the functionally monomeric protein, methionyl tRNA synthetase. From these investigations, we obtain important information such as the ligand induced correlation between different residues of this protein, asymmetric binding of the ligands to the two subunits of the protein as seen in the crystal structure analysis, and the path of communication between the anticodon region and the aminoacylation site. Here we are able to elucidate the role of dimer interface at a level of detail, which has not been captured so far.

Allostery and conformational free energy changes in human tryptophanyl-tRNA synthetase from essential dynamics and structure networks

The interdependence of the concept of allostery and enzymatic catalysis, and they being guided by conformational mobility is gaining increased prominence. However, to gain a molecular level understanding of llostery and hence of enzymatic catalysis, it is of utter importance that the networks of amino acids participating in allostery be deciphered. Our lab has been exploring the methods of network analysis combined with molecular dynamics simulations to understand allostery at molecular level. Earlier we had outlined methods to obtain communication paths and then to map the rigid/flexible regions of proteins through network parameters like the shortest correlated paths, cliques, and communities. In this article, we advance the methodology to estimate the conformational populations in terms of cliques/communities formed by interactions including the side-chains and then to compute the ligand-induced population shift. Finally, we obtain the free-energy landscape of the protein in equilibrium, characterizing the free-energy minima accessed by the protein complexes. We have chosen human tryptophanyl-tRNA synthetase (hTrpRS), a protein esponsible for charging tryptophan to its cognate tRNA during protein biosynthesis for this investigation. This is a multidomain protein exhibiting excellent allosteric communication. Our approach has provided valuable structural as well as functional insights into the protein. The methodology adopted here is highly generalized to illuminate the linkage between protein structure networks and conformational mobility involved in the allosteric mechanism in any protein with known structure.

Azospirillum lipoferum tRNAs: Fractionation and identification of tRNA species and the nucleotide sequence of tRNA(Asn) (QUU)

Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.

Identification and characterization of thionucleosides in the total tRNA of cucumber cotyledons

Total tRNA isolated from cucumber cotyledons grown in the presence of radioactive sulfur was analyzed for the occurrence of thionucleosides. The analysis revealed the presence of at least five thionucleosides which were identified as 5-methylaminomethyl-2-thiouridine (mnm5s2U), 2-methylthio-N6-isopentenyladenosine (ms2i6A), 2-methylthio-N6-hydroxyisopentenyladenosine (ms2io6A), 5-methyl-2-thiouridine (m5s2U) and N-[(9-beta-ribofuranosyl-2- methylthiopurine-2-yl)-carbamoyl]-threonine (ms2t6A). A comparison of relative amounts of these thionucleosides in the total tRNAs of dark-, and light-grown cotyledons shows that the relative amounts of ms2i6A, ms2io6A and ms2t6A remain unchanged whereas mnm5s2U increases with a concomitant decrease in the relative amounts of m5s2U after light treatment of dark-grown cotyledons.

Immunospecific binding of tRNA precursors containing N6-(delta 2-isopentenyl) adenosine

Antibodies specific for N6-(delta 2-isopentenyl) adenosine (i6A) were immobilized on Sepharose and this adsorbent (Sepharose-anti-i6A) was used to selectively isolate bacteriophage T4 tRNA precursors containing i6A/ms2i6A from an unfractionated population of 32P-labeled T4 RNAs. The results showed that antibodies to i6A selectively bound only those tRNA precursors containing i6A/ms2i6A. Binding of tRNA precursors by antibody and specificity of the binding was assessed by membrane binding using 32P-labeled tRNA precursor. Binding was highly specific for i6A/ms2i6A residues in the tRNA precursors. This binding can be used to separate modified from unmodified precursor RNAs and to study the biosynthetic pathways of tRNA precursors.

Antibodies specific for 1-methylguanosine as a probe of tRNA conformation

Antibodies specific for 1-methylguanosine (m1G) were produced by immunization of rabbits with a bovine serum albumin conjugate of m1G. Antibodies specificity was determined by measuring the inhibition of binding of 3H-m1G trialcohol by various nucleosides or related derivatives. The relative affinities of the unpurified antibodies for various nucleosides showed that m1G trialcohol had an 8-fold higher affinity than m1G; further, guanosine and 2'-O-methylguanosine had at least a 500-fold lower affinity than m1G. The antibodies were purified on m1G-AH-Sepharose column and subsequently immobilized to Sepharose. Immobilized m1G antibodies quantitatively and exclusively retained m1G-containing oligonucleotides derived from ribonuclease A digests of 32P-labeled phage T4 tRNAPro. On the other hand, intact 32P-labeled T4 tRNAPro or its precursor RNA(s) did not bind to the same column. These findings indicate that at least a portion of m1G adjacent to the 3' end of the anticodon in intact T4 tRNAPro is not accessible for antibody binding.