Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Processing of mutated human proinsulin to mature insulin in the non-endocrine cell line, CHO

Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

CD4+T cells from HIV-1-infected patients recognize wild-type and mutant human immunodeficiency virus-1 protease epitopes

P>Human immunodeficiency virus (HIV)-1 protease is a known target of CD8+ T cell responses, but it is the only HIV-1 protein in which no fully characterized HIV-1 protease CD4 epitopes have been identified to date. We investigated the recognition of HIV-1 protease by CD4+ T cells from 75 HIV-1-infected, protease inhibitor (PI)-treated patients, using the 5,6-carboxyfluorescein diacetate succinimidyl ester-based proliferation assay. In order to identify putative promiscuous CD4+ T cell epitopes, we used the TEPITOPE algorithm to scan the sequence of the HXB2 HIV-1 protease. Protease regions 4-23, 45-64 and 73-95 were identified; 32 sequence variants of the mentioned regions, encoding frequent PI-induced mutations and polymorphisms, were also tested. On average, each peptide bound to five of 15 tested common human leucocyte antigen D-related (HLA-DR) molecules. More than 80% of the patients displayed CD4+ as well as CD8+ T cell recognition of at least one of the protease peptides. All 35 peptides were recognized. The response was not associated with particular HLA-DR or -DQ alleles. Our results thus indicate that protease is a frequent target of CD4+ along with CD8+ proliferative T cell responses by the majority of HIV-1-infected patients under PI therapy. The frequent finding of matching CD4+ and CD8+ T cell responses to the same peptides may indicate that CD4+ T cells provide cognate T cell help for the maintenance of long-living protease-specific functional CD8+ T cells.

Muscle-specific regulation of tropomyosin gene expression and myofibrillogenesis differs among muscle systems examined at metamorphosis of the gastropod Haliotis rufescens

The spatial and temporal association of muscle-specific tropomyosin gene expression, and myofibril assembly and degradation during metamorphosis is analyzed in the gastropod mollusc. Haliotis rufescens. Metamorphosis of tile planktonic larva to the benthic juvenile includes rearrangement and atrophy of specific larval muscles, and biogenesis of the new juvenile muscle system. The major muscle of the larva - the larval retractor muscle - reorganizes at metamorphosis, with two suites of cells having different fates. The ventral cells degenerate, while the dorsal cells become part of the developing juvenile mantle musculature. Prior to these changes in myofibrillar structure, tropomyosin mRNA prevalence declines until undetectable in the ventral cells, while increasing markedly in the dorsal cells. In the foot muscle and right shell muscle, tropomyosin mRNA levels remain relatively stable, even trough myofibril content increases. In a population of median mesoderm cells destined to form de novo the major muscle of the juvenile and adult (the columellar muscle), tropomyosin expression is initiated at 45 h after induction of metamorphosis. Myofibrillar filamentous actin is not detected in these cells until about 7 days later. Given that patterns of tropomyosin mRNA accumulation in relation to myofibril assembly and disassembly differ significantly among the four major muscle systems examined, we suggest that different regulatory mechanisms, probably operating at both transcriptional and post-transcriptional levels, control the biogenesis and atrophy of different larval and postlarval muscles at metamorphosis.

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

In vitro study of CD133 human stem cells labeled with superparamagnetic iron oxide nanoparticles

Superparamagnetic iron oxide nanoparticles (SPIONs) are applied in stem cell labeling because of their high magnetic susceptibility as compared with ordinary paramagnetic species, their low toxicity, and their ease of magnetic manipulation. The present work is the study of CD133(+) stem cell labeling by SPIONs coupled to a specific antibody (AC133), resulting in the antigenic labeling of the CD133+ stem cell, and a method was developed for the quantification of the SPION content per cell, necessary for molecular imaging optimization. Flow cytometry analysis established the efficiency of the selection process and helped determine that the CD133 cells selected by chromatographic affinity express the transmembrane glycoprotein CD133. The presence of antibodies coupled to the SPION, expressed in the cell membrane, was observed by transmission electron microscopy. Quantification of the SPION concentration in the marked cells using the ferromagnetic resonance technique resulted in a value of 1.70 x 10 (13) mol iron (9.5 pg) or 7.0 x 10 (6) nanoparticles per cell ( the measurement was carried out in a volume of 2 mu L containing about 6.16 x 10 5 pg iron, equivalent to 4.5 x 10 (11) SPIONs). (c) 2008 Elsevier Inc. All rights reserved.

Expression of activated mutants of the human interleukin-3/interleukin-5 granulocyte-macrophage colony-stimulating factor receptor common beta subunit in primary hematopoietic cells induces factor-independent proliferation and differentiation

To date, several activating mutations have been discovered in the common signal-transducing subunit (h beta c) of the receptors for human granulocyte-macrophage colony-stimulating factor, interleukin-3, and interleukin-5. Two of these, Fl Delta and 1374N, result in a 37 amino acid duplication and a single amino acid substitution in the extracellular domain of h beta c, respectively. A third, V449E, results in a single amino acid substitution in the transmembrane domain, Previous studies comparing the activity of these mutants in different hematopoietic cell lines imply that the transmembrane and extracellular mutations act by different mechanisms and suggest the requirement for cell type-specific molecules in signalling. To characterize the ability of these mutant hpc subunits to mediate growth and differentiation of primary cells and hence investigate their oncogenic potential, we have expressed all three mutants in primary murine hematopoietic cells using retroviral transduction. It is shown that, whereas expression of either extracellular hpc mutant confers factor-independent proliferation and differentiation on cells of the neutrophil and monocyte lineages only, expression of the transmembrane mutant does so on these lineages as well as the eosinophil, basophil, megakaryocyte, and erythroid lineages, Factor-independent myeloid precursors expressing the transmembrane mutant display extended proliferation in liquid culture and in some cases yielded immortalized cell lines. (C) 1997 by The American Society of Hematology.

XPC polymorphisms play a role in tissue-specific carcinogenesis: a meta-analysis

XPC participates in the initial recognition of DNA damage during the DNA nucleotide excision repair process in global genomic repair. Polymorphisms in XPC gene have been analyzed in case-control studies to assess the cancer risk attributed to these variants, but results are conflicting. To clarify the impact of XPC polymorphisms in cancer risk, we performed a meta-analysis that included 33 published case-control studies. Polymorphisms analyzed were Lys939Gln and Ala499Val. The overall summary odds ratio (OR) for the associations of the 939Gln/Gln genotype with risk of cancer was 1.01 (95% confidence interval (95% CI): 0.94-1.09), but there were statistically significant associations for lung cancer, observed for the recessive genetic model (Lys/Lys + Lys/Gln vs Gln/Gln), (OR 1.30; 95% CI: 1.113-1.53), whereas for breast cancer a reduced but nonsignificant risk was observed for the same model (OR 0.87; 95% CI: 0.74-1.01). The results for Ala499Val showed a significant overall increase in cancer risk (OR 1.15; 95% CI: 1.02-1.31), and for bladder cancer in both the simple genetic model (Ala/Ala vs Val/Val) (OR 1.30; 95% CI: 1.04-1.61) and the recessive genetic model (Ala/Ala + Ala/Val vs Val/Val) (OR 1.32; 95% CI: 1.06-1.63). Our meta-analysis supports that polymorphisms in XPC may represent low-penetrance susceptibility gene variants for breast, bladder, head and neck, and lung cancer. XPC is a good candidate for large-scale epidemiological case-control studies that may lead to improvement in the management of highly prevalent cancers.

Generation and phenotypic characterization of new human ovarian cancer cell lines with the identification of antigens potentially recognizable by HLA-restricted cytotoxic T cells

This study describes a simple method for long-term establishment of human ovarian tumor lines and prediction of T-cell epitopes that could be potentially useful in the generation of tumor-specific cytotoxic T lymphocytes (CTLs), Nine ovarian tumor lines (INT.Ov) were generated from solid primary or metastatic tumors as well as from ascitic fluid, Notably all lines expressed HLA class I, intercellular adhesion molecule-1 (ICAM-1), polymorphic epithelial mucin (PEM) and cytokeratin (CK), but not HLA class II, B7.1 (CD80) or BAGE, While of the 9 lines tested 4 (INT.Ov1, 2, 5 and 6) expressed the folate receptor (FR-alpha) and 6 (INT.Ov1, 2, 5, 6, 7 and 9) expressed the epidermal growth factor receptor (EGFR); MAGE-1 and p185(HER-2/neu) were only found in 2 lines (INT.Ov1 and 2) and GAGE-1 expression in 1 line (INT.Ov2). The identification of class I MHC ligands and T-cell epitopes within protein antigens was achieved by applying several theoretical methods including: 1) similarity or homology searches to MHCPEP; 2) BIMAS and 3) artificial neural network-based predictions of proteins MACE, GAGE, EGFR, p185(HER-2/neu) and FR-alpha expressed in INT.Ov lines, Because of the high frequency of expression of some of these proteins in ovarian cancer and the ability to determine HLA binding peptides efficiently, it is expected that after appropriate screening, a large cohort of ovarian cancer patients may become candidates to receive peptide based vaccines. (C) 1997 Wiley-Liss, Inc.

Seroprevalence of Human Papillomavirus 6, 11, 16, and 18 in Young Primiparous Women in Sao Paulo, Brazil

Introduction: Data on epidemiology of HPV infection are needed for the development of human papillomavirus (HPV) vaccine recommendations, especially in countries where HPV vaccination is not yet included in public vaccination programs. The aim of this study was to determine the prevalence of serum antibodies to HPV types 6, 11, 16, and 18 and associated factors among young women after birth of the first child. Methods: This cross-sectional study was carried out in a large public maternity hospital in Sao Paulo, Brazil. Three hundred one women aged 15 to 24 years who gave birth to their first child were recruited between 43 and 60 days after delivery. Seroprevalence was performed using a type-specific enzyme-linked immunosorbent assay based on HPV Late protein 1 viruslike particles. The association of seroreactivity with these 4 HPV types with selected demographic and behavioral factors was assessed by Generalized Linear Model analysis. Results: Fifty-eight (19.3%) women (95% confidence interval, 15.0%-24.2%) had antibodies to any of the 4 viruslike particles tested. The overall seroprevalence rates of the HPV types were: HPV16, 9.0%; HPV18, 7.0%; and HPV 6+11, 7.7%, which are targeted by the HPV prophylactic vaccines. In the multivariate analysis, only age (inversely, P = 0.044 for trend) and previous sexually transmitted disease (P = 0.008) were 2 factors independently associated with HPV seropositivity. Conclusions: These data offer additional information on the epidemiology of HPV in a group of young Brazilian women after first delivery and contribute to establish a baseline of HPV seroprevalence against which post-HPV vaccine era seroprevalence can be compared.

Low human papillomavirus prevalence in head and neck cancer: results from two large case-control studies in high-incidence regions

Background Recent studies support an important role for human papillomavirus (HPV) in a subgroup of head and neck squamous cell carcinomas (HNSCC). We have evaluated the HPV deoxyribonucleic acid (DNA) prevalence as well as the association between serological response to HPV infection and HNSCC in two distinct populations from Central Europe (CE) and Latin America (LA). Methods Cases (n = 2214) and controls (n = 3319) were recruited from 1998 to 2003, using a similar protocol including questionnaire and blood sample collection. Tumour DNA from 196 fresh tissue biopsies was analysed for multiple HPV types followed by an HPV type-specific polymerase chain reaction (PCR) protocol towards the E7 gene from HPV 16. Using multiplex serology, serum samples were analysed for antibodies to 17 HPV types. Statistical analysis included the estimation of adjusted odds ratios (ORs) and the respective 95% confidence intervals (CIs). Results HPV16 E7 DNA prevalence among cases was 3.1% (6/196), including 4.4% in the oropharynx (3/68), 3.8% in the hypopharynx/larynx (3/78) and 0% among 50 cases of oral cavity carcinomas. Positivity for both HPV16 E6 and E7 antibodies was associated with a very high risk of oropharyngeal cancer (OR = 179, 95% CI 35.8-899) and hypopharyngeal/laryngeal cancer (OR = 14.9, 95% CI 2.92-76.1). Conclusions A very low prevalence of HPV DNA and serum antibodies was observed among cases in both CE and LA. The proportion of head and neck cancer caused by HPV may vary substantially between different geographical regions and studies that are designed to evaluate the impact of HPV vaccination on HNSCC need to consider this heterogeneity.

IRF8 Mutations and Human Dendritic-Cell Immunodeficiency

BACKGROUND The genetic analysis of human primary immunodeficiencies has defined the contribution of specific cell populations and molecular pathways in the host defense against infection. Disseminated infection caused by bacille Calmette-Guerin (BCG) vaccines is an early manifestation of primary immunodeficiencies, such as severe combined immunodeficiency. In many affected persons, the cause of disseminated BCG disease is unexplained. METHODS We evaluated an infant presenting with features of severe immunodeficiency, including early-onset disseminated BCG disease, who required hematopoietic stem-cell transplantation. We also studied two otherwise healthy subjects with a history of disseminated but curable BCG disease in childhood. We characterized the monocyte and dendritic-cell compartments in these three subjects and sequenced candidate genes in which mutations could plausibly confer susceptibility to BCG disease. RESULTS We detected two distinct disease-causing mutations affecting interferon regulatory factor 8 (IRF8). Both K108E and T80A mutations impair IRF8 transcriptional activity by disrupting the interaction between IRF8 and DNA. The K108E variant was associated with an autosomal recessive severe immunodeficiency with a complete lack of circulating monocytes and dendritic cells. The T80A variant was associated with an autosomal dominant, milder immunodeficiency and a selective depletion of CD11c+CD1c+ circulating dendritic cells. CONCLUSIONS These findings define a class of human primary immunodeficiencies that affect the differentiation of mononuclear phagocytes. They also show that human IRF8 is critical for the development of monocytes and dendritic cells and for antimycobacterial immunity. (Funded by the Medical Research Council and others.)

Non-Human Leukocyte Antigen Antibodies Reactive with Endothelial Cells Could Be Involved in Early Loss of Renal Allografts

Preformed donor-specific human leukocyte antigen (HLA) antibodies have been associated with allograft dysfunction and failure. However, recipients of HLA-identical kidneys can develop acute humoral rejection, implicating putative pathogenic antibodies that are directed against non-HLA antigens. We investigated the presence of endothelial cell reactive antibodies in 11 patients who experienced early loss of their transplanted kidneys owing to humoral rejection and 1 loss from renal venal thrombosis. We examined the potential efficacy of intravenous immunoglobulin to block the binding of these antibodies, as previously suggested for anti-HLA antibodies.