Regulation of the gene encoding glutathione S-transferase M1 (GSTM1) by the Myb oncoprotein

The identification of Myb 'target' genes will not only aid in the understanding of how overexpression of Myb, or expression of activated forms of Myb, leads to cellular transformation but will also shed light on its role in normal cells. Using a combination of an estrogen-regulated Myb-transformed cell line (ERMYB) and PCR-based subtractive hybridization, we have identified the gene (GSTM1) encoding the detoxification enzyme glutathione S-transferase M1 as being transcriptionally upregulated by Myb. Functional analysis of the GSTM1 promoter using reporter assays indicated that both the DNA binding and transactivation domains of Myb were required for transcriptional activation. Mutational analysis of consensus Myb-binding sites (MBS) in the promoter and electrophoretic mobility gel shift analysis indicated that one of the three potential MBS can bind Myb protein, and is the primary site involved in the regulation of this promoter by Myb.

Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Who chooses to inflation target?

In this article, we seek what are the factors behind a country`s decision to move to Inflation Targeting. We find that high past inflation, low debt levels and the absence of a nominal exchange rate anchor increase the probability that a country will end up opting for it. (C) 2007 Elsevier B.V. All rights reserved.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Nest site selection by a neotropical swarm-founding wasp: seasonal alternation of nest orientation

Nest orientation in social insects has been intensively studied in warmer and cooler climates, particularly in the northern hemisphere. Previous studies have consistently shown that species subjected to these climatic conditions prefer to select mostly southern locations where the nests can gain direct sunlight. However, very little is known on nest orientation in tropical and subtropical social insects. We studied nest orientations initiated by swarms throughout a year in a Brazilian swarm-founding wasp, Polybia paulista von Ihering (Hymenoptera: Polistinae). Swarms selected various orientations as nest sites, but there was a particular trend in that swarms in the winter period (May-August) preferred to build northward-facing nests. This preference is opposite from that of social wasps observed in the northern hemisphere. Colonies of this species can potentially last for many years with continuous nesting, but nesting activities of colonies during the winter are severely limited due to cool temperature and a shortened day length. Northward-facing nests are warmer through the gain of direct solar heat during the winter period; consequently, choosing northward-facing sites may be advantageous for swarms in terms of a shortened brood development and shortened time needed to increase metabolic rates during warm-up for flight.

An insight into the thermostability of a pair of xylanases: the role of hydrogen bonds

Xylanases are enzymes that are very tolerant to temperature. Their potential use in several biotechnological applications, such as animal food manufacture and pulp bleaching, is due to their intrinsic thermostability. The present report deals with two xylanases, the mesophilic xylanase from Bacillus circulans, BCX, and the thermophilic xylanase from Thermomyces lanuginosus,TLX. These enzymes belong to family 11, and they are the most structurally similar mesophilic-thermophilic pair. Molecular dynamics simulations were employed to investigate the factors responsible for the different thermostabilities exhibited by these structurally similar enzymes. Their active site is their most rigid region, and it is equally rigid at all temperatures. Inter and intramolecular interactions, hydrogen bonds in particular, are the key to the main differences between BCX and TLX. The intramolecular hydrogen bonds and salt bridges are important for maintenance of the backbone rigidity even at high temperature, and the highly solvated surface is a clear optimization in TLX compared with BCX. The main differences between these two enzymes can be found on the fingers domain, which indicates that this domain must be the target for the site-directed mutagenesis responsible for improving the temperature tolerance of this family of enzymes.

THE ANTERIOR CINGULATE CORTEX IS A TARGET STRUCTURE FOR THE ANXIOLYTIC-LIKE EFFECTS OF BENZODIAZEPINES ASSESSED BY REPEATED EXPOSURE TO THE ELEVATED PLUS MAZE AND FOS IMMUNOREACTIVITY

Prior experience with the elevated plus maze (EPM) increases the avoidance of rodents to the open arms and impairs the anxiolytic-like effects of benzodiazepines on the traditional behaviors evaluated upon re-exposure to the maze, a phenomenon known as one-trial tolerance. Risk assessment behaviors are also sensitive to benzodiazepines. During re-exposure to the maze, these behaviors reinstate the information-processing initiated during the first experience, and the detection of danger generates stronger open-arm avoidance. The present study investigated whether the benzodiazepine midazolam alters risk assessment behaviors and Fos protein distribution associated with test and retest sessions in the EPM. Naive or maze-experienced Wistar rats received either saline or midazolam (0.5 mg/kg i.p.) and were subjected to the EPM. Midazolam caused the usual effects on exploratory behavior, increasing exploratory activity of naive rats in the open arms and producing no effects on these conventional measures in rats re-exposed to the maze. Risk assessment behaviors, however, were sensitive to the benzodiazepine during both sessions, indicating anxiolytic-like effects of the drug in both conditions. Fos immunohistochemistry showed that midazolam injections were associated with a distinct pattern of action when administered before the test or retest session, and the anterior cingulate cortex, area 1 (Cg1), was the only structure targeted by the benzodiazepine in both situations. Bilateral infusions of midazolam into the Cg1 replicated the behavioral effects of the drug injected systemically, suggesting that this area is critically involved in the anxiolytic-like effects of benzodiazepines, although the behavioral strategy adopted by the animals appears to depend on the previous knowledge of the threatening environment. (C) 2009 IBRO. Published by Elsevier Ltd. All rights reserved.

Occasion setting in Pavlovian ambiguous target discriminations

Rats were trained in a Pavlovian serial ambiguous target discrimination, in which a target cue was reinforced if it was preceded by one stimulus (P -> T+) but was not reinforced if it was preceded by another stimulus (N -> T-). Test performance indicated that stimulus control by these features was weaker than that acquired by features trained within separate serial feature positive (P -> T+, T-) and serial feature negative (N -> W-, W+) discriminations. The form of conditioned responding and the patterns of transfer observed suggested that the serial ambiguous target discrimination was solved by occasion setting. The data are discussed in terms of the use of retrospective coding strategies when solving Pavlovian serial conditional discriminations, and the acquisition of special properties by both feature and target stimuli. (C) 2008 Published by Elsevier B.V.

Early Control of PTH and FGF23 in Normophosphatemic CKD Patients: A New Target in CKD-MBD Therapy?

Background and objectives: Levels of parathyroid hormone (PTH) and the phosphaturic hormone FGF23, a fibroblast growth factor (FGF) family member, increase early in chronic kidney disease (CKD) before the occurrence of hyperphosphatemia. This short-term 6-wk dose titration study evaluated the effect of two phosphate binders on PTH and FGF23 levels in patients with CKD stages 3 to 4. Design, setting, participants, and measurements: Patients were randomized to receive over a 6-wk period either calcium acetate (n = 19) or sevelamer hydrochloride (n = 21). Results: At baseline, patients presented with elevated fractional excretion of phosphate, serum PTH, and FGF23. During treatment with both phosphate binders there was a progressive decline in serum PTH and urinary phosphate, but no change in serum calcium or serum phosphate. Significant changes were observed for FGF23 only in sevelamer-treated patients. Conclusions: This study confirms the positive effects of early prescription of phosphate binders on PTH control. Prospective and long-term studies are necessary to confirm the effects of sevelamer on serum FGF23 and the benefits of this decrease on outcomes. Clin J Am Soc Nephrol 5: 286-291, 2010. doi: 10.2215/CJN.05420709

Intermittent target inhibition with dasatinib 100 mg once daily preserves efficacy and improves tolerability in imatinib-resistant and -intolerant chronic-phase chronic myeloid leukemia

Purpose Dasatinib is a BCR-ABL inhibitor, 325-fold more potent than imatinib against unmutated BCR-ABL in vitro. Phase II studies have demonstrated efficacy and safety with dasatinib 70 mg twice daily in chronic-phase (CP) chronic myelogenous leukemia (CML) after imatinib treatment failure. In phase I, responses occurred with once-daily administration despite only intermittent BCR-ABL inhibition. Once-daily treatment resulted in less toxicity, suggesting that toxicity results from continuous inhibition of unintended targets. Here, a dose-and schedule-optimization study is reported. Patients and Methods In this open-label phase III trial, 670 patients with imatinib-resistant or -intolerant CP-CML were randomly assigned 1: 1: 1: 1 between four dasatinib treatment groups: 100 mg once daily, 50 mg twice daily, 140 mg once daily, or 70 mg twice daily. Results With minimum follow-up of 6 months (median treatment duration, 8 months; range, = 1 to 15 months), marked and comparable hematologic (complete, 86% to 92%) and cytogenetic (major, 54% to 59%; complete, 41% to 45%) response rates were observed across the four groups. Time to and duration of cytogenetic response were similar, as was progression-free survival (8% to 11% of patients experienced disease progression or died). Compared with the approved 70-mg twice-daily regimen, dasatinib 100 mg once daily resulted in significantly lower rates of pleural effusion (all grades, 7% v 16%; P = .024) and grade 3 to 4 thrombocytopenia (22% v 37%; P = .004), and fewer patients required dose interruption (51% v 68%), reduction (30% v 55%), or discontinuation (16% v 23%). Conclusion Dasatinib 100 mg once daily retains the efficacy of 70 mg twice daily with less toxicity. Intermittent target inhibition with tyrosine kinase inhibitors may preserve efficacy and reduce adverse events.

Variation of Patterns of Malocclusion by Site of Pharyngeal Obstruction in Children

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR alpha transcriptional factors

Lima GA, Anhe GF, Giannocco G, Nunes MT, Correa-Giannella ML, Machado UF. Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR alpha transcriptional factors. Am J Physiol Endocrinol Metab 296: E132-E138, 2009. First published October 28, 2008; doi: 10.1152/ajpendo.90548.2008.-Skeletal muscle is a target tissue for approaches that can improve insulin sensitivity in insulin-resistant states. In muscles, glucose uptake is performed by the GLUT-4 protein, which is encoded by the SLC2A4 gene. SLC2A4 gene expression increases in response to conditions that improve insulin sensitivity, including chronic exercise. However, since chronic exercise improves insulin sensitivity, the increased SLC2A4 gene expression could not be clearly attributed to the muscle contractile activity per se and/or to the improved insulin sensitivity. The present study was designed to investigate the role of contractile activity per se in the regulation of SLC2A4 gene expression as well as in the participation of the transcriptional factors myocyte enhancer factor 2D (MEF2D), hypoxia inducible factor 1a (HIF-1a), and thyroid hormone receptor-alpha (TR alpha). The performed in vitro protocol excluded the interference of metabolic, hormonal, and neural effects. The results showed that, in response to 10 min of electrically induced contraction of soleus muscle, an early 40% increase in GLUT-4 mRNA (30 min) occurred, with a subsequent 65% increase (120 min) in GLUT-4 protein content. EMSA and supershift assays revealed that the stimulus rapidly increased the binding activity of MEF2D, HIF-1a, and TR alpha into the SLC2A4 gene promoter. Furthermore, chromatin immunoprecipitation assay confirmed, in native nucleosome, that contraction induced an approximate fourfold (P < 0.01) increase in MEF2D and HIF-1a-binding activity. In conclusion, muscle contraction per se enhances SLC2A4 gene expression and that involves MEF2D, HIF-1a, and TR alpha transcription factor activation. This finding reinforces the importance of physical activity to improve glycemic homeostasis independently of other additional insulin sensitizer approaches.