Bovine prion protein gene (PRNP) promoter polymorphisms modulate PRNP expression and may be responsible for differences in bovine spongiform encephalopathy susceptibility

The susceptibility of humans to the variant Creutzfeldt-Jakob disease is greatly influenced by polymorphisms within the human prion protein gene (PRNP). Similar genetic differences exist in sheep, in which PRNP polymorphisms modify the susceptibility to scrapie. However, the known coding polymorphisms within the bovine PRNP gene have little or no effect on bovine spongiform encephalopathy (BSE) susceptibility in cattle. We have recently found a tentative association between PRNP promoter polymorphisms and BSE susceptibility in German cattle (Sander, P., Hamann, H., Pfeiffer, I., Wemheuer, W., Brenig, B., Groschup, M., Ziegler, U., Distl, O., and Leeb, T. (2004) Neurogenetics 5, 19-25). A plausible hypothesis explaining this observation could be that the bovine PRNP promoter polymorphisms cause changes in PRNP expression that might be responsible for differences in BSE incubation time and/or BSE susceptibility. To test this hypothesis, we performed a functional promoter analysis of the different bovine PRNP promoter alleles by reporter gene assays in vitro and by measuring PRNP mRNA levels in calves with different PRNP genotypes in vivo. Two variable sites, a 23-bp insertion/deletion (indel) polymorphism containing a RP58-binding site and a 12-bp indel polymorphism containing an SP1-binding site, were investigated. Band shift assays indicated differences in transcription factor binding to the different alleles at the two polymorphisms. Reporter gene assays demonstrated an interaction between the two postulated transcription factors and lower expression levels of the ins/ins allele compared with the del/del allele. The in vivo data revealed substantial individual variation of PRNP expression in different tissues. In intestinal lymph nodes, expression levels differed between the different PRNP genotypes.

Enhanced Cold Tolerance in Transgenic Tobacco Expressing a Chloroplast Omega-3 Fatty Acid Desaturase Gene under the Control of a Cold-inducible Promoter

A new cold-inducible genetic construct was cloned using a chloroplast-specific omega-3-fatty acid desaturase gene (FAD7) under the control of a cold-inducible promoter (cor15a) from Arabidopsis thaliana. RT-PCR confirmed a marked increase in FAD7 expression, in young Nicotiana tabacum (cv. Havana) plants harboring cor15a-FAD7, after a short-term exposure to cold. When young, cold-induced tobacco seedlings were exposed to low-temperature (0.5, 2 or 3.5 degrees C) for up to 44 days, survival within independent cor15a-FAD7 transgenic lines (40.2-96%) was far superior to the wild type (6.7-10.2%). In addition, the major trienoic fatty acid species remained stable in cold-induced cor15a-FAD7 N. tabacum plants under prolonged cold storage while the levels of hexadecatrienoic acid (16:3) and octadecatrienoic acid (18:3) declined in wild type plants under the same conditions (79 and 20.7% respectively). Electron microscopy showed that chloroplast membrane ultrastructure in cor15a-FAD7 transgenic plants was unaffected by prolonged exposure to cold temperatures. In contrast, wild type plants experienced a loss of granal stacking and disorganization of the thylakoid membrane under the same conditions. Changes in membrane integrity coincided with a precipitous decline in leaf chlorophyll concentration and low survival rates in wild type plants. Cold-induced double transgenic N. alata (cv. Domino Mix) plants, harboring both the cor15a-FAD7 cold-tolerance gene and a cor15a-IPT dark-tolerance gene, exhibited dramatically higher survival rates (89-90%) than wild type plants (2%) under prolonged cold storage under dark conditions (2 degrees C for 50 days).

Transcriptional upregulation of the p21Cip1 promoter by STAT3 and nuclear ErbB2

Over-expression of the receptor tyrosine kinase ErbB2 is prevalent in approximately 30% of human breast carcinomas and confers Taxol resistance. In breast cancer cells, Taxol induces tubulin polymerization and hyperstable microtubule formation. This in turn prematurely activates Cdc2 kinase allowing early entry into the G2/M phase of the cell cycle resultant in mitotic catastrophe followed by apoptosis. Over-expression of ErbB2 upregulates p21Cip1, which inhibits Cdc2 activation, and leads to Taxol resistance in patients. However, the mechanism of ErbB2-mediated p21 Cip1 upregulation is unclear. Here in this study, we investigated the mechanism of ErbB2 downstream signaling events leading to upregulation. The CDKN1A (p21Cip1) gene promoter contains numerous cis-elements including a Signal transducer and activator of transcription (STAT) Inducable Element (SIE) located at -679 kb. Our studies showed ErbB2 overexpressing cells had increased activated levels of STAT3, and therefore we hypothesized that STAT3 is responsible for the upregulation of the p21Cip1 promoter by ErbB2. EMSA and ChIP assays confirmed the binding of STAT3 to the p21Cip1 promoter and luciferase assays showed higher p21 Cip1 promoter activity in ErbB2 over-expressing transfectants when compared to parental cells, in a STAT3 binding site dependant manner. Additionally, reduced level of STAT3 led to reduced p21Cip1 protein expression and promoter activity indicating that both the STAT3 binding site and STAT3 protein are required for ErbB2-mediated p21Cip1 upregulation. Further investigation of ErbB2 downstream signaling showed increased Src kinase activity in ErbB2 over-expressing cells which was required for ErbB2-mediated STAT3 activation and p21Cip1 increase. Treatment of ErbB2 over-expressing resistant cells with STAT3 inhibitor peptides sensitized the cells to Taxol. In addition to classical signal transduction pathways, I identified a novel ErbB2 mediated regulatory mechanism of p21Cip1. I found that a nuclear ErbB2 and STAT3 complex binds directly to the p21Cip1 promoter offering a non-classical mechanism of p21Cip1 promoter regulation. These data suggest that ErbB2 over-expression can confer Taxol resistance of breast cancer cells by transcriptional upregulation of p21 Cip1 via activation of STAT3 by Src kinase and also by cooperation with nuclear ErbB2. The data suggest a potential clinical mechanism for STAT3 inhibitors in sensitizing ErbB2 over-expressing breast cancers to Taxol. ^

14-3-3 ZETA OVEREXPRESSION SERVES AS A NOVEL MOLECULAR SWITCH TURNING TGF-BETA FROM TUMOR SUPPRESSOR TO TUMOR PROMOTER

TGF-β plays an important role in differentiation and tissue morphogenesis as well as cancer progression. However, the role of TGF-β in cancer is complicate. TGF-β has primarily been recognized as tumor suppressor, because it can directly inhibit cell proliferation of normal and premalignant epithelial cell. However, in the last stage of tumor progression, TGF-β functions as tumor promoter to enhance tumor cells metastatic dissemination and expands metastatic colonies. Currently, the mechanism of how TGF-β switches its role from tumor suppressor to promoter still remains elusive. Here we identify that overexpression of 14-3-3ζ inhibits TGF-β’s cell cytostatic program through destabilizing p53 in non-transformed human mammary epithelial cells. Mechanistically, we found that 14-3-3ζ overexpression leads to 14-3-3σ downregulation, thereby activates PI3K/Akt signaling pathway and degrades p53, and further inhibits TGF-β induced p21 expression and cell cytostatic function. In addition, we found that overexpression of 14-3-3ζ promotes TGF-β induced breast cancer cells bone metastatic colonization through stabilizing Gli2, which is an important co-transcriptional factor for p-smad2 to activate PTHrP expression and bone osteolytic effect. Taken together, we reveal a novel mechanism that 14-3-3ζ dictates the tumor suppressor or metastases promoter activities of TGF-β signaling pathway through switching p-smad2 binding partner from p53 to Gli2. The expected results will not only provide us the better understanding of the important role of 14-3-3ζ in the early stage of breast cancer development, but also deeply impact our knowledge of signaling mechanisms underlying the complex roles of TGF-β in cancer, which will give us a more accurate strategy to determine when and how anti-TGF-β targeted therapy might be effective.

The effects of DNA cytosine methylation on H -ras promoter structure and function

The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Minimal DNA sequences that control the cell lineage-specific expression of the pro$\alpha$2(I) collagen promoter in transgenic mice

The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Characterization of the cholesterol 7$\alpha$-hydroxylase promoter in hypercholesterolemia -resistant rabbits

Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^

A distinct element involved in the lipopolysaccharide activation of the tumor necrosis factor -alpha promoter in a promonocytic cell line, THP-1

TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^

Proceedings of the Twenty-Sixth Annual Biochemical Engineering Symposium

This volume contains the Proceedings of the Twenty-Sixth Annual Biochemical Engineering Symposium held at Kansas State University on September 21, 1996. The program included 10 oral presentations and 14 posters. Some of the papers describe the progress of ongoing projects, and others contain the results of completed projects. Only brief summaries are given of some of the papers; many of the papers will be published in full elsewhere. A listing of those who attended is given below. ContentsForeign Protein Production from SV40 Early Promoter in Continuous Cultures of Recombinant CHO Cells - Gautam Banik, Paul Todd, and Dhinakar Kampala Enhanced Cell Recruitment Due to Cell-Cell Interactions - Brad Farlow and Matthias Nollert The Recirculation of Hybridoma Suspension Cultures: Effects on Cell Death, Metabolism and Mab Productivity - Peng Jin and Carole A. Heath The Importance of Enzyme Inactivation and Self-Recovery in Cometabolic Biodegradation of Chlorinated Solvents - Xi-Hui Zhang, Shanka Banerji, and Rakesh Bajpai Phytoremediation of VOC contaminated Groundwater using Poplar Trees - Melissa Miller, Jason Dana, L.C. Davis, Murlidharan Narayanan, and L.E. Erickson Biological Treatment of Off-Gases from Aluminum Can Production: Experimental Results and Mathematical Modeling - Adeyma Y. Arroyo, Julio Zimbron, and Kenneth F. Reardon Inertial Migration Based Separation of Chlorella Microalgae in Branched Tubes - N.M. Poflee, A.L. Rakow, D.S. Dandy, M.L. Chappell, and M.N. Pons Contribution of Electrochemical Charge to Protein Partitioning in Aqueous Two-Phase Systems - Weiyu Fan and Charles C. Glatz Biodegradation of Some Commercial Surfactants Used in Bioremediation - Jun Gu, G.W. Preckshot, S.K. Banerji, and Rakesh Bajpai Modeling the Role of Biomass in Heavy Metal Transport Ln Vadose Zone - K.V. Nedunuri, L.E. Erickson, and R.S. Govindaraju Multivariable Statistical Methods for Monitoring Process Quality: Application to Bioinsecticide Production by 73 89 Bacillus Thuringiensis - c. Puente and M.N. Karim The Use of Polymeric Flocculants in Bacterial Lysate Streams - H. Graham, A.S. Cibulskas and E.H. Dunlop Effect of Water Content on transport of Trichloroethylene in a Chamber with Alfalfa Plants - Muralidharan Narayanan, Jiang Hu, Lawrence C. Davis, and Larry E. Erickson Detection of Specific Microorganisms using the Arbitrary Primed PCR in the Bacterial Community of Vegetated Soil - X. Wu and L.C. Davis Flux Enhancement Using Backpulsing - V.T. Kuberkar and R.H. Davis Chromatographic Purification of Oligonucleotides: Comparison with Electrophoresis - Stephen P. Cape, Ching-Yuan Lee, Kevin Petrini, Sean Foree, Micheal G. Sportiello and Paul Todd Determining Singular Arc Control Policies for Bioreactor Systems Using a Modified Iterative Dynamic Programming Algorithm - Arun Tholudur and W. Fred Ramirez Pressure Effect on Subtilisins Measured via FTIR, EPR and Activity Assays, and Its Impact on Crystallizations - J.N. Webb, R.Y. Waghmare, M.G. Bindewald, T.W. Randolph, J.F. Carpenter, C.E. Glatz Intercellular Calcium Changes in Endothelial Cells Exposed to Flow - Laura Worthen and Matthias Nollert Application of Liquid-Liquid Extraction in Propionic Acid Fermentation - Zhong Gu, Bonita A. Glatz, and Charles E. Glatz Purification of Recombinant T4 Lysozyme from E. Coli: Ion-Exchange Chromatography - Weiyu Fan, Matt L. Thatcher, and Charles E. Glatz Recovery and Purification of Recombinant Beta-Glucuronidase from Transgenic Corn - Ann R. Kusnadi, Roque Evangelista, Zivko L. Nikolov, and John Howard Effects of Auxins and cytokinins on Formation of Catharanthus Roseus G. Don Multiple Shoots - Ying-Jin Yuan, Yu-Min Yang, Tsung-Ting Hu, and Jiang Hu Fate and Effect of Trichloroethylene as Nonaqueous Phase Liquid in Chambers with Alfalfa - Qizhi Zhang, Brent Goplen, Sara Vanderhoof, Lawrence c. Davis, and Larry E. Erickson Oxygen Transport and Mixing Considerations for Microcarrier Culture of Mammalian Cells in an Airlift Reactor - Sridhar Sunderam, Frederick R. Souder, and Marylee Southard Effects of Cyclic Shear Stress on Mammalian Cells under Laminar Flow Conditions: Apparatus and Methods - M.L. Rigney, M.H. Liew, and M.Z. Southard

Dopamine receptor 4 promoter polymorphism modulates memory and neuronal responses to salience

Animal models and human functional imaging data implicate the dopamine system in mediating enhanced encoding of novel stimuli into human memory. A separate line of investigation suggests an association between a functional polymorphism in the promoter region for the human dopamine 4 receptor gene (DRD4) and sensitivity to novelty. We demonstrate, in two independent samples, that the -521Cmayor queT DRD4 promoter polymorphism determines the magnitude of human memory enhancement for contextually novel, perceptual oddball stimuli in an allele dose-dependent manner. The genotype-dependent memory enhancement conferred by the C allele is associated with increased neuronal responses during successful encoding of perceptual oddballs in the ventral striatum, an effect which is again allele dose-dependent. Furthermore, with repeated presentations of oddball stimuli, this memory advantage decreases, an effect mirrored by adaptation of activation in the hippocampus and substantia nigra/ventral tegmental area in C carriers only. Thus, a dynamic modulation of human memory enhancement for perceptually salient stimuli is associated with activation of a dopaminergic-hippocampal system, which is critically dependent on a functional polymorphism in the DRD4 promoter region.

Regulation of the human p21/WAF1/Cip1 promoter in hepatic cells by functional interactions between Sp1 and Smad family members

The cell cycle inhibitor p21/WAF1/Cip1 is expressed in many cell types and is regulated by p53-dependent and p53-independent mechanisms. p21 is an important regulator of hepatocyte cell cycle, differentiation, and liver development, but little is known about the regulation of its synthesis in hepatocytes. We report herein that the p21 gene is constitutively expressed in human hepatoma HepG2 cells. Deletion analysis of the p21 promoter showed that it contains a distal (positions −2,300/−210) and a proximal (positions −124 to −61) region that act synergistically to achieve high levels of constitutive expression. The proximal region that consists of multiple Sp1 binding sites is essential for constitutive p21 promoter activity in hepatocytes. This region also mediates the transcriptional activation of the p21 promoter by members of the Smad family of proteins, which play important role in the transduction of extracellular signals such as transforming growth factor β, activin, etc. Constitutive expression of p21 was severely reduced by a C-terminally truncated form of Smad4 that was shown previously to block signaling through Smads. Smad3/4 and to a much lesser extent Smad2/4 caused high levels of transcriptional activation of the p21 promoter. Transactivation was compromised by N- or C-terminally truncated forms of Smad3. By using Gal4-Sp1 fusion proteins, we show that Smad proteins can activate gene transcription via functional interactions with the ubiquitous factor Sp1. These data demonstrate that Smad proteins and Sp1 participate in the constitutive or inducible expression of the p21 gene in hepatic cells.