INTERACTIONS OF RARE-EARTH LENS WITH BOVINE BLOOD CU(ZN)-SUPEROXIDE DISMUTASE

The interactions of lanthanium trichloride and terbium trichloride with bovine blood Cu (Zn)-superoxide dismutase [Cu(Zn)-SOD] in the aqueous solution of hexamethylenetetrarnine buffer (pH = 6.3) have been studied by using fluorescece, CD and ESR spectra. The results indicated that rare earth ions were coordinated to the carboxyl groups of acidic amino acid residues which were far from active center of the Cu(Zn)-SOD molecule and only lightly disturbed the secondary structure of the enzyme protien, and made the coordination structure of enzyme-bound CU2+ come from the rhombchedron to the axial shape at 77 K and the activity of Cu(Zn)-SOD enzyme was not nearly changed at room temperature.

The complete mitochondrial genome sequence of the cutlassfish Trichiurus japonicus (Perciformes: Trichiuridae) : Genome characterization and phylogenetic considerations

Mitochondrial genome sequence and structure analysis has become a powerful tool for studying molecular evolution and phylogenetic relationships. To understand the systematic status of Trichiurus japonicus in suborder Scombroidei, we determined the complete mitochondrial genome (mitogenome) sequence using the long-polymerase chain reaction (long-PCR) and shotgun sequencing method. The entire mitogenome is 16,796 by in length and has three unusual features, including (1) the absence of tRNA(Pro) gene, (2) the possibly nonfunctional light-strand replication origin (O-L) showing a shorter loop in secondary structure and no conserved motif (5'-GCCGG-3'), (3) two sets of the tandem repeats at the 5' and 3' ends of the control region. The three features seem common for Trichiurus mitogenomes, as we have confirmed them in other three T. japonicus individuals and in T nanhaiensis. Phylogenetic analysis does not support the monophyly of Trichiuridae, which is against the morphological result. T. japonicus is most closely related to those species of family Scombridae; they in turn have a sister relationship with Perciformes members including suborders Acanthuroidei, Caproidei, Notothenioidei, Zoarcoidei, Trachinoidei, and some species of Labroidei, based on the current dataset of complete mitogenome. T japonicus together with T. brevis, T lepturus and Aphanopus carbo form a clade distinct from Lepidopus caudatus in terms of the complete Cyt b sequences. T. japonicus mitogenome, as the first discovered complete mitogenome of Trichiuridae, should provide important information on both genomics and phylogenetics of Trichiuridae. (C) 2009 Elsevier B.V. All rights reserved.

Structural analysis of peptides of PSII light-harvesting complexes in siphonous green algae, Codium fragile

peptide composition and arrangement of 4 major light-harvesting complexes LHCP1-3 and LHCP3, isolated from siphonous green algae (Codium fragile (Sur.) Hariot.) were investigated. LHCP1 showed five main peptides, 34.4, 31.5, 29.5, 28.2 and 26.5 kD in SDS-PAGE, the 34.4 and 31.5 kD peptides were never found in higher plants. LHCP3 contained the other four kinds of LHCP1 peptides except 34.4 kD, while LHCP3, consisted of only 28.2 and 26.5 kD peptides. We found that 34.4, 28.2 and 26.5 kD peptides were easy to decompose from LHCP1 when subjected to SDS-PACE without pretreatment. They might be located at the exterior of LHCP1, while the 31.5 and 29.5 kD peptides were at the central part. The 28.2 and 26.5 kD peptides often occurred in CPa, the center complex of PS II. They are possibly the LHC II peptides tightly associated with CC II. According to the results described above, a peptide map of LHCP1 was sketched.

Synthesizing Regularity Exposing Attributes in Large Protein Databases

This thesis describes a system that synthesizes regularity exposing attributes from large protein databases. After processing primary and secondary structure data, this system discovers an amino acid representation that captures what are thought to be the three most important amino acid characteristics (size, charge, and hydrophobicity) for tertiary structure prediction. A neural network trained using this 16 bit representation achieves a performance accuracy on the secondary structure prediction problem that is comparable to the one achieved by a neural network trained using the standard 24 bit amino acid representation. In addition, the thesis describes bounds on secondary structure prediction accuracy, derived using an optimal learning algorithm and the probably approximately correct (PAC) model.

Análise do grau de conservação de resíduos em proteínas com estrutura 3D resolvida utilizando o SMS.

HSSP e entropia relativa. Módulos do SMS para análise de conservação. Discussão e trabalhos futuros.

Poly-transformation

King, R. D. and Ouali, M. (2004) Poly-transformation. In proceedings of 5th International Conference on Intelligent Data Engineering and Automated Learning (IDEAL 2004). Springer LNCS 3177 p99-107

A dichotomic search algorithm for mining and learning in domain-specific logics

Ferr?, S. and King, R. D. (2004) A dichotomic search algorithm for mining and learning in domain-specific logics. Fundamenta Informaticae. IOS Press. To appear

Analysis of Sequence Periodicity in E. coli Proteins: Empirical Investigation of the ?Duplication and Divergence? Theory of Protein Evolution

Gatherer, D., and McEwan, N.R. (2003). Analysis of sequence periodicity in E. coli proteins: empirical investigation of the 'duplication and divergence' theory of protein evolution. Journal of Molecular Evolution 57, 149-158. RAE2008

Functionally active targeting domain of the beta-adrenergic receptor kinase: an inhibitor of G beta gamma-mediated stimulation of type II adenylyl cyclase.

The beta-adrenergic receptor kinase (beta ARK) phosphorylates its membrane-associated receptor substrates, such as the beta-adrenergic receptor, triggering events leading to receptor desensitization. beta ARK activity is markedly stimulated by the isoprenylated beta gamma subunit complex of heterotrimeric guanine nucleotide-binding proteins (G beta gamma), which translocates the kinase to the plasma membrane and thereby targets it to its receptor substrate. The amino-terminal two-thirds of beta ARK1 composes the receptor recognition and catalytic domains, while the carboxyl third contains the G beta gamma binding sequences, the targeting domain. We prepared this domain as a recombinant His6 fusion protein from Escherichia coli and found that it had both independent secondary structure and functional activity. We demonstrated the inhibitory properties of this domain against G beta gamma activation of type II adenylyl cyclase both in a reconstituted system utilizing Sf9 insect cell membranes and in a permeabilized 293 human embryonic kidney cell system. Gi alpha-mediated inhibition of adenylyl cyclase was not affected. These data suggest that this His6 fusion protein derived from the carboxyl terminus of beta ARK1 provides a specific probe for defining G beta gamma-mediated processes and for studying the structural features of a G beta gamma-binding domain.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DPP IV resistance and insulin releasing activity of a novel di-substituted analogue of glucose-dependent insulinotropic polypeptide, (Ser(2)-Asp(13))GIP

Structure-function studies suggest that preservation of the N-terminus and secondary structure of glucose-dependent insulinotropic polypeptide (GIP) is important for biological activity. Therefore, a novel di-substituted analogue of GIP, (Ser(2)-Asp(13))GIP, containing a negatively charged Asp residue in place of an Ala in position 13, seas synthesised and evaluated for in vitro biological activity. Incubation with dipeptidyl peptidase IV (DPP IV) showed the half-lives of GIP and (Ser(2)-Asp(13))GIP to be 2.3 and >4 h, respectively. Insulin releasing studies in clonal pancreatic BRIN-BD11 cells demonstrated that (Ser(2)-Asp(13))GIP (10(-12) to 10(-7) mol/l) was significantly less potent (60-90%; P

Functional analysis of the C-terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in Salmonella enterica

WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.

FLT1 Genetic Variation Predisposes to Neovascular AMD in Ethnically Diverse Populations and Alters Systemic FLT1 Expression

Purpose: Current understanding of the genetic risk factors for age-related macular degeneration (AMD) is not sufficiently predictive of the clinical course. The VEGF pathway is a key therapeutic target for treatment of neovascular AMD; however, risk attributable to genetic variation within pathway genes is unclear. We sought to identify single nucleotide polymorphisms (SNPs) associated with AMD within the VEGF pathway.
Methods: Using a tagSNP, direct sequencing and meta-analysis approach within four ethnically diverse cohorts, we identified genetic risk present in FLT1, though not within other VEGF pathway genes KDR, VEGFA, or VASH1. We used ChIP and ELISA in functional analysis.
Results: The FLT1 SNPs rs9943922, rs9508034, rs2281827, rs7324510, and rs9513115 were significantly associated with increased risk of neovascular AMD. Each association was more significant after meta-analysis than in any one of the four cohorts. All associations were novel, within noncoding regions of FLT1 that do not tag for coding variants in linkage disequilibrium. Analysis of soluble FLT1 demonstrated higher expression in unaffected individuals homozygous for the FLT1 risk alleles rs9943922 (P = 0.0086) and rs7324510 (P = 0.0057). In silico analysis suggests that these variants change predicted splice sites and RNA secondary structure, and have been identified in other neovascular pathologies. These data were supported further by murine chromatin immunoprecipitation demonstrating that FLT1 is a target of Nr2e3, a nuclear receptor gene implicated in regulating an AMD pathway.
Conclusions: Although exact variant functions are not known, these data demonstrate relevancy across ethnically diverse genetic backgrounds within our study and, therefore, hold potential for global efficacy.

Probing the Unfolded Configurations of a β-Hairpin Using Sketch-Map

This work examines the conformational ensemble involved in β-hairpin folding by means of advanced molecular dynamics simulations and dimensionality reduction. A fully atomistic description of the protein and the surrounding solvent molecules is used, and this complex energy landscape is sampled by means of parallel tempering metadynamics simulations. The ensemble of configurations explored is analyzed using the recently proposed sketch-map algorithm. Further simulations allow us to probe how mutations affect the structures adopted by this protein. We find that many of the configurations adopted by a mutant are the same as those adopted by the wild-type protein. Furthermore, certain mutations destabilize secondary-structure-containing configurations by preventing the formation of hydrogen bonds or by promoting the formation of new intramolecular contacts. Our analysis demonstrates that machine-learning techniques can be used to study the energy landscapes of complex molecules and that the visualizations that are generated in this way provide a natural basis for examining how the stabilities of particular configurations of the molecule are affected by factors such as temperature or structural mutations.

Estratégias de alteração da funcionalidade de proteínas de soja

Este trabalho teve como principal objetivo estudar e modificar as propriedades funcionais das proteínas de soja de forma a otimizar e diversificar a sua aplicação industrial. Para tal, foram propostas e estudadas quatro estratégias: i) extração do isolado de proteínas de soja (IPS) a partir de diferentes matérias-primas, ii) adição de galactomananas (GM) com graus de ramificação e massas moleculares diferentes, iii) hidrólise enzimática controlada das proteínas de soja, iv) processamento por alta pressão hidrostática. O estudo e a interpretação da influência destas estratégias sobre as propriedades funcionais das proteínas de soja, nomeadamente, na capacidade gelificante e emulsionante, foram realizados recorrendo fundamentalmente a ensaios reológicos dinâmicos a baixas deformação, espectroscopia de infravermelho, electroforeses, calorimetria diferencial de varrimento e ensaios de microscopia confocal de varrimento laser. O estudo da extração e caracterização dos isolados de proteínas de soja obtidos a partir de diferentes matérias-primas permitiu concluir que as caraterísticas físico-químicas dos isolados são dependentes da origem da matéria-prima de extração e da severidade dos tratamentos industriais prévios à extração do isolado. Contudo, as propriedades viscoelásticas dos géis obtidos por aquecimento controlado não foram significativamente distintas embora tenha sido possível relacionar o grau de agregação com a diminuição da temperatura de gelificação e com o aumento inicial dos módulos viscoelásticos. As alterações sofridas pelos isolados de origem comercial mostraram ser irreversíveis resultando em géis menos rígidos e com maior caráter viscoso. A adição de galactomanana alterou significativamente o mecanismo de gelificação induzido termicamente das proteínas de soja, bem como as propriedades viscoelásticas dos géis e a microestrutura dos géis, demonstrando-se a ocorrência de separação de fases, em virtude da incompatibilidade termodinâmica entre os biopolímeros, resultando em géis mais rígidos e no decréscimo da temperatura de gelificação. A extensão destas alterações foi dependente da massa molecular, grau de ramificação e da razão IPS/GM. O efeito da hidrólise enzimática por ação da bromelina, nas propriedades gelificantes e emulsionantes das proteínas de soja, mostrou ser dependente do grau de hidrólise (GH). Valores de GH inferiores a 15 % melhoraram as propriedades gelificantes das proteínas de soja. Por outro lado, o aumento do GH teve um efeito negativo nas propriedades emulsionantes, o qual foi atenuado por adição da goma de alfarroba, com efeito positivo na gelificação das proteínas de soja. A concentração crítica limite de compatibilidade entre os hidrolisados de proteína de soja e a goma de alfarroba aumentou com o decréscimo do GH e da massa molecular do polissacacrídeo. O efeito da AP sobre as propriedades físico-químicas e funcionais dos IPS foi influenciado pela origem do isolado e pelas condições de tratamento. O processamento até 100 MPa desencadeou um aumento da atividade emulsionante e considerável melhoria da capacidade gelificante. Contudo, valores de pressão superiores promoveram a desnaturação das proteínas constituintes dos isolados, resultando no decréscimo da temperatura de gelificação e numa re-associação das subunidades proteicas, diminuindo a elasticidade dos géis finais. Os resultados sugeriram que as alterações nas proteínas de soja promovidas durante o tratamento por AP constituem um fator limitante para o desdobramento e re-associação durante o aquecimento térmico, necessários para a formação e fortalecimento de gel formado. O processamento por AP influenciou a estrutura secundária e a microestrutura das amostras. A presença de GA teve um papel baroprotetor. Assim, com este trabalho demonstrou-se que com as estratégias seguidas para manipulação das propriedades funcionais de proteínas de soja, nomeadamente através da adição de um polissacarídeo com propriedades estruturais controladas, da adequada combinação da adição de um polissacarídeo neutro com a hidrólise controlada das proteínas ou com tratamento por alta pressão, é possível a criação de novas funcionalidades, com utilidade no desenvolvimento de novas formulações alimentares, permitindo expandir a aplicação destas proteínas vegetais.