934 resultados para Human Genome Project.


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Expression data contribute significantly to the biological value of the sequenced human genome, providing extensive information about gene structure and the pattern of gene expression. ESTs, together with SAGE libraries and microarray experiment information, provide a broad and rich view of the transcriptome. However, it is difficult to perform large-scale expression mining of the data generated by these diverse experimental approaches. Not only is the data stored in disparate locations, but there is frequent ambiguity in the meaning of terms used to describe the source of the material used in the experiment. Untangling semantic differences between the data provided by different resources is therefore largely reliant on the domain knowledge of a human expert. We present here eVOC, a system which associates labelled target cDNAs for microarray experiments, or cDNA libraries and their associated transcripts with controlled terms in a set of hierarchical vocabularies. eVOC consists of four orthogonal controlled vocabularies suitable for describing the domains of human gene expression data including Anatomical System, Cell Type, Pathology and Developmental Stage. We have curated and annotated 7016 cDNA libraries represented in dbEST, as well as 104 SAGE libraries,with expression information,and provide this as an integrated, public resource that allows the linking of transcripts and libraries with expression terms. Both the vocabularies and the vocabulary-annotated libraries can be retrieved from http://www.sanbi.ac.za/evoc/. Several groups are involved in developing this resource with the aim of unifying transcript expression information.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Background: The ubiquitin-dependent protein degradation pathway is essential for the proteolysis of intracellular proteins and peptides. Deubiquitinating enzymes constitute a complex protein family involved in a multitude of cellular processes. The ubiquitin-specific proteases (UBP) are a group of enzymes whose predicted function is to reverse the ubiquitinating reaction by removing ubiquitin from a large variety of substrates. We have lately reported the characterization of human USP25, a specific-ubiquitin protease gene at 21q11.2, with a specific pattern of expression in murine fetal brains and adult testis. Results: Database homology searches at the DNA and protein levels and cDNA library screenings led to the identification of a new UBP member in the human genome, named USP28, at 11q23. This novel gene showed preferential expression in heart and muscle. Moreover, cDNA, expressed sequence tag and RT-PCR analyses provided evidence for alternatively spliced products and tissue-specific isoforms. Concerning function, USP25 overexpression in Down syndrome fetal brains was shown by real-time PCR. Conclusions: On the basis of the genomic and protein sequence as well as the functional data, USP28 and USP25 establish a new subfamily of deubiquitinating enzymes. Both genes have alternatively spliced exons that could generate protein isoforms with distinct tissue-specific activity. The overexpression of USP25 in Down syndrome fetal brains supports the gene-dosage effects suggested for other UBP members related to aneuploidy syndromes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Idiopathic hypogonadotropic hypogonadism (IHH) is defined by absent or incomplete puberty and characterised biochemically by low levels of sex steroids, with low or inappropriately normal gonadotropin hormones. IHH is frequently accompanied by non-reproductive abnormalities, most commonly anosmia, which is present in 50-60% of cases and defines Kallmann syndrome. The understanding of IHH has undergone rapid evolution, both in respect of genetics and breadth of phenotype. Once considered in monogenic Mendelian terms, it is now more coherently understood as a complex genetic condition. Oligogenic and complex genetic-environmental interactions have now been identified, with physiological and environmental factors interacting in genetically susceptible individuals to alter the clinical course and phenotype. These potentially link IHH to ancient evolutionary pressures on the ancestral human genome.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

ABSTRACT: BACKGROUND: It is accepted that a woman's lifetime risk of developing breast cancer after menopause is reduced by early full term pregnancy and multiparity. This phenomenon is thought to be associated with the development and differentiation of the breast during pregnancy. METHODS: In order to understand the underlying molecular mechanisms of pregnancy induced breast cancer protection, we profiled and compared the transcriptomes of normal breast tissue biopsies from 71 parous (P) and 42 nulliparous (NP) healthy postmenopausal women using Affymetrix Human Genome U133 Plus 2.0 arrays. To validate the results, we performed real time PCR and immunohistochemistry. RESULTS: We identified 305 differentially expressed probesets (208 distinct genes). Of these, 267 probesets were up- and 38 down-regulated in parous breast samples; bioinformatics analysis using gene ontology enrichment revealed that up-regulated genes in the parous breast represented biological processes involving differentiation and development, anchoring of epithelial cells to the basement membrane, hemidesmosome and cell-substrate junction assembly, mRNA and RNA metabolic processes and RNA splicing machinery. The down-regulated genes represented biological processes that comprised cell proliferation, regulation of IGF-like growth factor receptor signaling, somatic stem cell maintenance, muscle cell differentiation and apoptosis. CONCLUSIONS: This study suggests that the differentiation of the breast imprints a genomic signature that is centered in the mRNA processing reactome. These findings indicate that pregnancy may induce a safeguard mechanism at post-transcriptional level that maintains the fidelity of the transcriptional process.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

PURPOSE: Mutations in IDH3B, an enzyme participating in the Krebs cycle, have recently been found to cause autosomal recessive retinitis pigmentosa (arRP). The MDH1 gene maps within the RP28 arRP linkage interval and encodes cytoplasmic malate dehydrogenase, an enzyme functionally related to IDH3B. As a proof of concept for candidate gene screening to be routinely performed by ultra high throughput sequencing (UHTs), we analyzed MDH1 in a patient from each of the two families described so far to show linkage between arRP and RP28. METHODS: With genomic long-range PCR, we amplified all introns and exons of the MDH1 gene (23.4 kb). PCR products were then sequenced by short-read UHTs with no further processing. Computer-based mapping of the reads and mutation detection were performed by three independent software packages. RESULTS: Despite the intrinsic complexity of human genome sequences, reads were easily mapped and analyzed, and all algorithms used provided the same results. The two patients were homozygous for all DNA variants identified in the region, which confirms previous linkage and homozygosity mapping results, but had different haplotypes, indicating genetic or allelic heterogeneity. None of the DNA changes detected could be associated with the disease. CONCLUSIONS: The MDH1 gene is not the cause of RP28-linked arRP. Our experimental strategy shows that long-range genomic PCR followed by UHTs provides an excellent system to perform a thorough screening of candidate genes for hereditary retinal degeneration.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Abstract : Gene duplication is an essential source of material for the origin of genetic novelties. The reverse transcription of source gene mRNA followed by the genomic insertion of the resulting cDNA - retroposition - has provided the human genome with at least ~3600 detectable retrocopies. We find that ~30% of these retrocopies are transcribed, generally in testes. Their transcription often relies on preexisting regulatory elements (or open chromatin) close to their insertion site, which is illustrated by mRNA molecules containing retrocopies fused to their neighboring genes. Retrocopies appear to have been profoundly shaped by selection. Consistently, human retrocopies with an intact open reading (ORF) are more often transcribed than retropseudogenes, which leads to a minimal estimate of 120 functional retrogenes present in our genome. We also performed an analysis of Ka/Ks for human retrocopies. This analysis demonstrates that several intact retrocopies evolved under purifying selection and yields an estimated formation rate of ~1 retrogene per million year in the primate lineage. Using DNA sequencing and evolutionary simulations, we have identified 7 such primate-specific retrogenes that emerged on the lineage leading to humans In therian genomes, we found an excess of retrogenes with X-linked parents. Expression analyses support the idea that this "out of X" movement was driven by natural selection to produce autosomal functional counterparts for X-linked genes, which are silenced during male meiosis. Phylogenetic dating of this "out of X" movement suggests that our sex chromosomes arose about 180 MYA ago and are thus much younger than previously thought. Finally, we have also analyzed young gene duplications (and deletions) that arose by non allelic-homologous recombination and are not fixed in species. Using wild-caught and laboratory animals, we detected thousands of DNA segments that are polymorphic in copy number in mice. These copy number variants were found to profoundly alter the transcriptome of several mouse tissues. Strikingly, their influence on gene expression is not limited to the gene they contain but seems to extend to genes located up to 1.5 million bases away.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Krüppel-associated box domain-zinc finger proteins (KRAB-ZFPs) are tetrapod-specific transcriptional repressors encoded in the hundreds by the human genome. In order to explore their as yet ill-defined impact on gene expression, we developed an ectopic repressor assay, allowing the study of KRAB-mediated transcriptional regulation at hundreds of different transcriptional units. By targeting a drug-controllable KRAB-containing repressor to gene-trapping lentiviral vectors, we demonstrate that KRAB and its corepressor KAP1 can silence promoters located several tens of kilobases (kb) away from their DNA binding sites, with an efficiency which is generally higher for promoters located within 15 kb or less. Silenced promoters exhibit a loss of histone H3-acetylation, an increase in H3 lysine 9 trimethylation (H3K9me3), and a drop in RNA Pol II recruitment, consistent with a block of transcriptional initiation following the establishment of silencing marks. Furthermore, we reveal that KRAB-mediated repression is established by the long-range spreading of H3K9me3 and heterochromatin protein 1 beta (HP1beta) between the repressor binding site and the promoter. We confirm the biological relevance of this phenomenon by documenting KAP1-dependent transcriptional repression at an endogenous KRAB-ZFP gene cluster, where KAP1 binds to the 3' end of genes and mediates propagation of H3K9me3 and HP1beta towards their 5' end. Together, our data support a model in which KRAB/KAP1 recruitment induces long-range repression through the spread of heterochromatin. This finding not only suggests auto-regulatory mechanisms in the control of KRAB-ZFP gene clusters, but also provides important cues for interpreting future genome-wide DNA binding data of KRAB-ZFPs and KAP1.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

A family history of coronary artery disease (CAD), especially when the disease occurs at a young age, is a potent risk factor for CAD. DNA collection in families in which two or more siblings are affected at an early age allows identification of genetic factors for CAD by linkage analysis. We performed a genomewide scan in 1,168 individuals from 438 families, including 493 affected sibling pairs with documented onset of CAD before 51 years of age in men and before 56 years of age in women. We prospectively defined three phenotypic subsets of families: (1) acute coronary syndrome in two or more siblings; (2) absence of type 2 diabetes in all affected siblings; and (3) atherogenic dyslipidemia in any one sibling. Genotypes were analyzed for 395 microsatellite markers. Regions were defined as providing evidence for linkage if they provided parametric two-point LOD scores >1.5, together with nonparametric multipoint LOD scores >1.0. Regions on chromosomes 3q13 (multipoint LOD = 3.3; empirical P value <.001) and 5q31 (multipoint LOD = 1.4; empirical P value <.081) met these criteria in the entire data set, and regions on chromosomes 1q25, 3q13, 7p14, and 19p13 met these criteria in one or more of the subsets. Two regions, 3q13 and 1q25, met the criteria for genomewide significance. We have identified a region on chromosome 3q13 that is linked to early-onset CAD, as well as additional regions of interest that will require further analysis. These data provide initial areas of the human genome where further investigation may reveal susceptibility genes for early-onset CAD.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

BACKGROUND: The P-type II ATPase gene family encodes proteins with an important role in adaptation of the cell to variation in external K+, Ca2+ and Na2+ concentrations. The presence of P-type II gene subfamilies that are specific for certain kingdoms has been reported but was sometimes contradicted by discovery of previously unknown homologous sequences in newly sequenced genomes. Members of this gene family have been sampled in all of the fungal phyla except the arbuscular mycorrhizal fungi (AMF; phylum Glomeromycota), which are known to play a key-role in terrestrial ecosystems and to be genetically highly variable within populations. Here we used highly degenerate primers on AMF genomic DNA to increase the sampling of fungal P-Type II ATPases and to test previous predictions about their evolution. In parallel, homologous sequences of the P-type II ATPases have been used to determine the nature and amount of polymorphism that is present at these loci among isolates of Glomus intraradices harvested from the same field. RESULTS: In this study, four P-type II ATPase sub-families have been isolated from three AMF species. We show that, contrary to previous predictions, P-type IIC ATPases are present in all basal fungal taxa. Additionally, P-Type IIE ATPases should no longer be considered as exclusive to the Ascomycota and the Basidiomycota, since we also demonstrate their presence in the Zygomycota. Finally, a comparison of homologous sequences encoding P-type IID ATPases showed unexpectedly that indel mutations among coding regions, as well as specific gene duplications occur among AMF individuals within the same field. CONCLUSION: On the basis of these results we suggest that the diversification of P-Type IIC and E ATPases followed the diversification of the extant fungal phyla with independent events of gene gains and losses. Consistent with recent findings on the human genome, but at a much smaller geographic scale, we provided evidence that structural genomic changes, such as exonic indel mutations and gene duplications are less rare than previously thought and that these also occur within fungal populations.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

A haplotype is an m-long binary vector. The XOR-genotype of two haplotypes is the m-vector of their coordinate-wise XOR. We study the following problem: Given a set of XOR-genotypes, reconstruct their haplotypes so that the set of resulting haplotypes can be mapped onto a perfect phylogeny (PP) tree. The question is motivated by studying population evolution in human genetics and is a variant of the PP haplotyping problem that has received intensive attention recently. Unlike the latter problem, in which the input is '' full '' genotypes, here, we assume less informative input and so may be more economical to obtain experimentally. Building on ideas of Gusfield, we show how to solve the problem in polynomial time by a reduction to the graph realization problem. The actual haplotypes are not uniquely determined by the tree they map onto and the tree itself may or may not be unique. We show that tree uniqueness implies uniquely determined haplotypes, up to inherent degrees of freedom, and give a sufficient condition for the uniqueness. To actually determine the haplotypes given the tree, additional information is necessary. We show that two or three full genotypes suffice to reconstruct all the haplotypes and present a linear algorithm for identifying those genotypes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Le neuroblastome (NB), tumeur spécifique de l'enfant, se situe au second rang en terme de¦fréquence des tumeurs solides dans la population pédiatrique (1). Il dérive des cellules¦primitives de la crête neurale, une population de cellules embryonnaires dotées d'une¦capacité de différentiation en une panoplie de tissus très variés, dont le système nerveux¦sympathique (2). Cette origine explique la très grande hétérogénéité du NB, tant du point de¦vue biologique que clinique (3). Malgré un traitement intensif et multimodal (chirurgie,¦chimiothérapie à haute dose, greffe de moelle osseuse et immunothérapie), seuls 30 % des¦patients de haut risque (stade IV) survivent sans rechute. La forte résistance du¦neuroblastome de haut grade aux diverses thérapies est une des causes probable du¦pronostic sombre de cette tumeur. Les thérapies actuelles étant insuffisamment efficaces, il¦est primordial de comprendre les mécanismes impliqués dans le processus de résistance¦afin d'élaborer de nouveaux traitements, mieux ciblés, capables de contrer toute résistance¦(4).¦Il a été démontré que certains cancers, tels que les tumeurs du poumon, du sein, de la¦prostate ou du colon, possédaient des cellules souches cancéreuses (CSCs) (5). Ces¦dernières, définies comme étant une petite sous-population de cellules malignes, jouent un¦rôle prépondérant dans l'initiation et la progression tumorale. Elles partagent certaines¦propriétés avec les cellules souches physiologiques, telles que la capacité d'autorenouvellement,¦un potentiel de prolifération indéfini, une dépendance à un¦microenvironnement spécifique, une faculté de pluripotence et une résistance accrue aux¦drogues (6). Ce modèle de CSCs a également été étudié pour le NB (7), permettant ainsi¦d'avancer l'hypothèse selon laquelle cette population de CSCs serait responsable de la¦résistance aux chimiothérapies des cellules tumorales du NB.¦Afin de tenter d'éclaircir le caractère résistant aux drogues des CSCs du NB, nous avons¦sélectionné des sous-populations cellulaires résistantes, en traitant par divers agents¦cytotoxiques (cisplatine, doxorubicine, rapamycine et vincristine) cinq lignées différentes de¦neuroblastes. Dans le but d'établir un potentiel enrichissement en CSCs au sein de ces¦sous-populations par rapport aux populations contrôles non traitées, nous avons testé leurs¦fonctions d'auto-renouvellement et de clonogénicité. Ces propriétés ont été respectivement¦mises en évidence par la capacité des cellules à former des sphères de plusieurs¦générations dans des conditions de culture inhibant l'adhésion cellulaire et par la mesure de¦la croissance cellulaire en milieu semi-solide (soft agar assay). Une analyse d'expression¦génique effectuée préalablement par microarray (Human Genome U133Plus 2.0 Affymetrix¦GeneChip oligonucleotide) dans le laboratoire avait révélé une liste de gènes surexprimés¦dans les CSCs, dont fait partie mdr1 (8). Ce gène code la protéine de transport Pgp (Pglycoprotein),¦impliquée dans le mécanisme de résistance (9,10). Une étude par cytométrie¦en flux de l'expression de MDR1 dans nos diverses populations a également été réalisée¦afin de mettre en évidence une potentielle surexpression de ce gène au sein des cellules¦résistantes aux chimiothérapies.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

We report on two patients with de novo subtelomeric terminal deletion of chromosome 6p. Patient 1 is an 8-month-old female born with normal growth parameters, typical facial features of 6pter deletion, bilateral corectopia, and protruding tongue. She has severe developmental delay, profound bilateral neurosensory deafness, poor visual contact, and hypsarrhythmia since the age of 6 months. Patient 2 is a 5-year-old male born with normal growth parameters and unilateral hip dysplasia; he has a characteristic facial phenotype, bilateral embryotoxon, and moderate mental retardation. Further characterization of the deletion, using high-resolution array comparative genomic hybridization (array-CGH; Agilent Human Genome kit 244 K), revealed that Patient 1 has a 8.1 Mb 6pter-6p24.3 deletion associated with a contiguous 5.8 Mb 6p24.3-6p24.1 duplication and Patient 2 a 5.7 Mb 6pter-6p25.1 deletion partially overlapping with that of Patient 1. Complementary FISH and array analysis showed that the inv del dup(6) in Patient 1 originated de novo. Our results demonstrate that simple rearrangements are often more complex than defined by standard techniques. We also discuss genotype-phenotype correlations including previously reported cases of deletion 6p.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Infectious diseases, both in their endemic and epidemic forms, have shaped the human genome. Ecology has also contributed to geographically constrained pressures on human populations. There are now multiple examples of population-specific genetic variants that modulate susceptibility to infection - several of which have been observed solely in Europeans. The pathogen genome also mutates and adapts to individuals and common alleles in populations. The current understanding has benefited from genome-wide association studies as well as from rapid progress in the genetic characterization of Mendelian immunodeficiencies that are defined by susceptibility to specific pathogens. It is expected that current efforts to characterize rare human genetic variants will contribute to the understanding of severe manifestations of common infections in European and other human groups.

Relevância:

80.00% 80.00%

Publicador: