Allele-specific silencing of mutant huntingtin in rodent brain and human stem cells.

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder resulting from polyglutamine expansion in the huntingtin (HTT) protein and for which there is no cure. Although suppression of both wild type and mutant HTT expression by RNA interference is a promising therapeutic strategy, a selective silencing of mutant HTT represents the safest approach preserving WT HTT expression and functions. We developed small hairpin RNAs (shRNAs) targeting single nucleotide polymorphisms (SNP) present in the HTT gene to selectively target the disease HTT isoform. Most of these shRNAs silenced, efficiently and selectively, mutant HTT in vitro. Lentiviral-mediated infection with the shRNAs led to selective degradation of mutant HTT mRNA and prevented the apparition of neuropathology in HD rat's striatum expressing mutant HTT containing the various SNPs. In transgenic BACHD mice, the mutant HTT allele was also silenced by this approach, further demonstrating the potential for allele-specific silencing. Finally, the allele-specific silencing of mutant HTT in human embryonic stem cells was accompanied by functional recovery of the vesicular transport of BDNF along microtubules. These findings provide evidence of the therapeutic potential of allele-specific RNA interference for HD.

Epigenetic regulatory elements associate with specific histone modifications to prevent silencing of telomeric genes.

In eukaryotic cells, transgene expression levels may be limited by an unfavourable chromatin structure at the integration site. Epigenetic regulators are DNA sequences which may protect transgenes from such position effect. We evaluated different epigenetic regulators for their ability to protect transgene expression at telomeres, which are commonly associated to low or inconsistent expression because of their repressive chromatin environment. Although to variable extents, matrix attachment regions (MARs), ubiquitous chromatin opening element (UCOE) and the chicken cHS4 insulator acted as barrier elements, protecting a telomeric-distal transgene from silencing. MARs also increased the probability of silent gene reactivation in time-course experiments. Additionally, all MARs improved the level of expression in non-silenced cells, unlike other elements. MARs were associated to histone marks usually linked to actively expressed genes, especially acetylation of histone H3 and H4, suggesting that they may prevent the spread of silencing chromatin by imposing acetylation marks on nearby nucleosomes. Alternatively, an UCOE was found to act by preventing deposition of repressive chromatin marks. We conclude that epigenetic DNA elements used to enhance and stabilize transgene expression all have specific epigenetic signature that might be at the basis of their mode of action.

Contribution of Intronic miR-338-3p and Its Hosting Gene AATK to Compensatory β-Cell Mass Expansion.

The elucidation of the mechanisms directing β-cell mass regeneration and maintenance is of interest, because the deficit of β-cell mass contributes to diabetes onset and progression. We previously found that the level of the microRNA (miRNA) miR-338-3p is decreased in pancreatic islets from rodent models displaying insulin resistance and compensatory β-cell mass expansion, including pregnant rats, diet-induced obese mice, and db/db mice. Transfection of rat islet cells with oligonucleotides that specifically block miR-338-3p activity increased the fraction of proliferating β-cells in vitro and promoted survival under proapoptotic conditions without affecting the capacity of β-cells to release insulin in response to glucose. Here, we evaluated the role of miR-338-3p in vivo by injecting mice with an adeno-associated viral vector permitting specific sequestration of this miRNA in β-cells. We found that the adeno-associated viral construct increased the fraction of proliferating β-cells confirming the data obtained in vitro. miR-338-3p is generated from an intron of the gene coding for apoptosis-associated tyrosine kinase (AATK). Similarly to miR-338-3p, we found that AATK is down-regulated in rat and human islets and INS832/13 β-cells in the presence of the cAMP-raising agents exendin-4, estradiol, and a G-protein-coupled Receptor 30 agonist. Moreover, AATK expression is reduced in islets of insulin resistant animal models and selective silencing of AATK in INS832/13 cells by RNA interference promoted β-cell proliferation. The results point to a coordinated reduction of miR-338-3p and AATK under insulin resistance conditions and provide evidence for a cooperative action of the miRNA and its hosting gene in compensatory β-cell mass expansion.

Different Effects of BORIS/CTCFL on Stemness Gene Expression, Sphere Formation and Cell Survival in Epithelial Cancer Stem Cells.

Cancer stem cells are cancer cells characterized by stem cell properties and represent a small population of tumor cells that drives tumor development, progression, metastasis and drug resistance. To date, the molecular mechanisms that generate and regulate cancer stem cells are not well defined. BORIS (Brother of Regulator of Imprinted Sites) or CTCFL (CTCF-like) is a DNA-binding protein that is expressed in normal tissues only in germ cells and is re-activated in tumors. Recent evidences have highlighted the correlation of BORIS/CTCFL expression with poor overall survival of different cancer patients. We have previously shown an association of BORIS-expressing cells with stemness gene expression in embryonic cancer cells. Here, we studied the role of BORIS in epithelial tumor cells. Using BORIS-molecular beacon that was already validated, we were able to show the presence of BORIS mRNA in cancer stem cell-enriched populations (side population and spheres) of cervical, colon and breast tumor cells. BORIS silencing studies showed a decrease of sphere formation capacity in breast and colon tumor cells. Importantly, BORIS-silencing led to down-regulation of hTERT, stem cell (NANOG, OCT4, SOX2 and BMI1) and cancer stem cell markers (ABCG2, CD44 and ALDH1) genes. Conversely, BORIS-induction led to up-regulation of the same genes. These phenotypes were observed in cervical, colon and invasive breast tumor cells. However, a completely different behavior was observed in the non-invasive breast tumor cells (MCF7). Indeed, these cells acquired an epithelial mesenchymal transition phenotype after BORIS silencing. Our results demonstrate that BORIS is associated with cancer stem cell-enriched populations of several epithelial tumor cells and the different phenotypes depend on the origin of tumor cells.

IMP2 provides an alternative to LIN28B for LET-7 target gene protection and glioma stem cell maintenance

Glioblastoma multiforme (GBM) is the most frequent and lethal primary brain tumor in adults. Accumulating evidence suggests that tumors comprise a hierarchical organization that is, at least partially, not genetically driven. Cells that reside at the apex of this hierarchy are commonly referred to as cancer stem cells (CSCs) and are believed to largely contribute to recurrence and therapeutic failure. Although the complexity of epigenetic regulation of the genome precludes prediction as to which epigenetic changes dominate CSC specification in different cancer types, the ability of microRNAs (miRNAs) to fine-tune expression of entire gene networks places them among prime candidates for establishing CSC properties. In this study we characterized the miRNA expression profile of primary GBM grown either under conditions that enrich for GSCs or their differentiated non-tumorigenic progeny (DGCs). Although, we identified a subset of miRNAs that was strongly differentially expressed between GSCs and DGCs, we observed that in GSCs both let-7 and, paradoxically, their target genes are highly expressed, suggesting protection against let-7 action. Using PAR-CLIP we show that insulin-like growth factor-2 mRNA-binding protein 2 (IMP2) provides a mechanism for let-7 target gene protection that represents an alternative to LIN28A/B, which abrogates let-7 biogenesis in normal embryonic and certain malignant stem cells. By direct binding to miRNA recognition elements, IMP2 protects its targets from let-7 mediated decay. Importantly, depletion of IMP2 in GSCs strongly impairs their self- renewal properties and tumorigenicity in vivo, a phenotype that can be rescued by expression of LIN28B, suggesting that IMP2 mainly contributes to GSC maintenance by protecting let-7 target genes from silencing. Using mouse models, we show that depletion of IMP2 in neural stem cells (NSCs) induces let-7 target gene down-regulation, impairs their clonogenic capacity, and affects differentiation. Taken together, our observations describe a novel regulatory function of IMP2 in the let-7 axis whereby it supports GSC and NSC specification. Résumé (Français) Le glioblastome (GBM) est la tumeur primaire maligne du cerveau la plus fréquente. De nombreuses études ont démontré l'existence d'une organisation hiérarchique des cellules cancéreuses liée à des mécanismes épigénétiques. Les cellules qui se trouvent au sommet de cette hiérarchie sont appelées cellules souches cancéreuses (CSC), et contribuent à l'échec thérapeutique. Bien que la complexité des régulateurs épigénétiques permette difficilement de prédire quel mécanisme contribue le plus aux propriétés des CSC, la capacité des microRNAs (miRNAs) de réguler des réseaux entiers de gènes, les placent comme des candidats de premiers choix. Ici, nous avons caractérisé le profil d'expression des miRNAs dans des tumeurs primaires de GBM cultivées dans des conditions qui enrichissent soit pour les CSC, soit pour leur contrepartie de cellules cancéreuses différences (CCD). De manière surprenante et paradoxale la famille de miRNA let-7 et leurs gènes cibles étaient hautement exprimés dans les CSC, suggérant un mécanisme de protection contre l'action des let-7. Avec l'aide de la technologie PAR-CLIP, nous démontrons que la protéine IMP2, protège les mRNAs de l'action des let-7 et représente une alternative à Lin28A/B, qui d'ordinaire réprime fortement la maturation des let-7 dans les cellules souches embryonnaires et divers cancers. En se liant à la région ciblée par les let-7, IMP2 protège ses transcrits de l'action de cette classe de microRNA qui est tumoro-supressive. La déplétion d'IMP2 dans des CSC de GBM réduit fortement leur clonogénicité in vitro et leur tumorigénicité in vivo. Ceci peut être reversé en introduisant Lin28B dans des CSC de GBM, suggérant qu'IMP2 exerce ses fonctions pro-tumorigéniques en modulant l'axe let-7. Avec l'aide de modèles murins, nous observons que la déplétion de IMP2 dans les cellules souches neurales (CSN) induit une baisse de leur clonogénicité et des cibles des miRNAs let-7, suggérant une conservation de ce mécanisme entre les CSC de GBM et les CSN. En résumé, nos observations définissent une nouvelle fonction de IMP2 dans l'axe let-7 par lequel il contribue au maintien des propriétés des CSC et des CSN.

Fibroblast Growth Factor 8 and its Receptors in The Growth and Angiogenesis of Experimental Breast Cancer . With Special Reference to Thrombospondin-1 as a Novel Target Gene for FGF-8

The growth of breast cancer is regulated by hormones and growth factors. Recently, aberrant fibroblast growth factor (FGF) signalling has been strongly implicated in promoting the progression of breast cancer and is thought to have a role in the development of endocrine resistant disease. FGFs mediate their auto- and paracrine signals through binding to FGF receptors 1-4 (FGFR1-4) and their isoforms. Specific targets of FGFs in breast cancer cells and the differential role of FGFRs, however, are poorly described. FGF-8 is expressed at elevated levels in breast cancer, and it has been shown to act as an angiogenic, growth promoting factor in experimental models of breast cancer. Furthermore, it plays an important role in mediating androgen effects in prostate cancer and in some breast cancer cell lines. We aimed to study testosterone (Te) and FGF-8 regulated genes in Shionogi 115 (S115) breast cancer cells, characterise FGF-8 activated intracellular signalling pathways and clarify the role of FGFR1, -2 and -3 in these cells. Thrombospondin-1 (TSP-1), an endogenous inhibitor of angiogenesis, was recognised as a Te and FGF-8 regulated gene. Te repression of TSP-1 was androgen receptor (AR)-dependent. It required de novo protein synthesis, but it was independent of FGF-8 expression. FGF-8, in turn, downregulated TSP-1 transcription by activating the ERK and PI3K pathways, and the effect could be reversed by specific kinase inhibitors. Differential FGFR1-3 action was studied by silencing each receptor by shRNA expression in S115 cells. FGFR1 expression was a prerequisite for the growth of S115 tumours, whereas FGFR2 expression alone was not able to promote tumour growth. High FGFR1 expression led to a growth advantage that was associated with strong ERK activation, increased angiogenesis and reduced apoptosis, and all of these effects could be reversed by an FGFR inhibitor. Taken together, the results of this thesis show that FGF-8 and FGFRs contribute strongly to the regulation of the growth and angiogenesis of experimental breast cancer and support the evidence for FGF-FGFR signalling as one of the major players in breast cancers.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

A SEPALLATA gene is involved in the development and ripening of strawberry (Fragaria X ananassa Duch.) fruit, a non-climacteric tissue

Climacteric and non-climacteric fruits have traditionally been viewed as representing two distinct programmes of ripening associated with differential respiration and ethylene hormone effects. In climacteric fruits, such as tomato and banana, the ripening process is marked by increased respiration and is induced and co-ordinated by ethylene, while in non-climacteric fruits, such as strawberry and grape, it is controlled by an ethylene-independent process with little change in respiration rate. The two contrasting mechanisms, however, both lead to texture, colour, and flavour changes that probably reflect some common programmes of regulatory control. It has been shown that a SEPALLATA(SEP)4-like gene is necessary for normal ripening in tomato. It has been demonstrated here that silencing a fruit-related SEP1/2-like (FaMADS9) gene in strawberry leads to the inhibition of normal development and ripening in the petal, achene, and receptacle tissues. In addition, analysis of transcriptome profiles reveals pleiotropic effects of FaMADS9 on fruit development and ripening-related gene expression. It is concluded that SEP genes play a central role in the developmental regulation of ripening in both climacteric and non-climacteric fruits. These findings provide important information to extend the molecular control of ripening in a non-climacteric fruit beyond the limited genetic and cultural options currently available.

Rescue of gene expression by modified REST decoy oligonucleotides in a cellular model of Huntington's disease

Transcriptional dysfunction is a prominent hallmark of Huntington's disease (HD). Several transcription factors have been implicated in the aetiology of HD progression and one of the most prominent is repressor element 1 (RE1) silencing transcription factor (REST). REST is a global repressor of neuronal gene expression and in the presence of mutant Huntingtin increased nuclear REST levels lead to elevated RE1 occupancy and a concomitant increase in target gene repression, including brain-derived neurotrophic factor. It is of great interest to devise strategies to reverse transcriptional dysregulation caused by increased nuclear REST and determine the consequences in HD. Thus far, such strategies have involved RNAi or mutant REST constructs. Decoys are double-stranded oligodeoxynucleotides corresponding to the DNA-binding element of a transcription factor and act to sequester it, thereby abrogating its transcriptional activity. Here, we report the use of a novel decoy strategy to rescue REST target gene expression in a cellular model of HD. We show that delivery of the decoy in cells expressing mutant Huntingtin leads to its specific interaction with REST, a reduction in REST occupancy of RE1s and rescue of target gene expression, including Bdnf. These data point to an alternative strategy for rebalancing the transcriptional dysregulation in HD.

Role of SOCS-1 Gene on Melanoma Cell Growth and Tumor Development

Melanoma is the most aggressive form of skin cancer, and its incidence has increased dramatically over the years. The murine B16F10 melanoma in syngeneic C57Bl/6 mice has been used as a highly aggressive model to investigate tumor development. Presently, we demonstrate in the B16F10-Nex2 subclone that silencing of SOCS-1, a negative regulator of Jak/Stat pathway, leads to reversal of the tumorigenic phenotype and inhibition of melanoma cell metastasis. SOCS-1 silencing with short hairpin RNA affected tumor growth and cell cycle regulation with arrest at the S phase with large-sized nuclei, reduced cell motility, and decreased melanoma cell invasion through Matrigel. A clonogenic assay showed that SOCS-1 acted as a modulator of resistance to anoikis. In addition, down-regulation of SOCS-1 decreased the expression of epidermal growth factor receptor ( mainly the phosphorylated-R), Ins-R alpha, and fibroblast growth factor receptor. In vivo, silencing of SOCS-1 inhibited subcutaneous tumor growth and metastatic development in the lungs. Because SOCS-1 is expressed in most melanoma cell lines and bears a relation with tumor invasion, thickness, and stage of disease, the present results on the effects of SOCS-1 silencing in melanoma suggest that this regulating protein can be a target of cancer therapy.

Evidence of epigenetic regulation of the tumor suppressor gene cluster flanking RASSF1 in breast cancer cell lines

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Perfil mutacional do gene APC em pacientes com polipose adenomatosa familial no estado do Pará

O câncer colorretal é um grave problema de saúde pública na região norte, sendo a 3a neoplasia mais frequente entre os homens e a 2a entre as mulheres. Cerca de 10% destes tumores são hereditários e a polipose adenomatosa familial está entre as principais causas destes. Mutações no gene APC são responsáveis pelo desenvolvimento de tumores nestes pacientes e estão presentes desde a fase mais precoce na carcinogênese, além disso, existe uma relação entre o tipo de mutação e apresentação clínica da doença. Até o presente momento não existe uma publicação com o perfil de mutação do gene APC na região norte do país. Este trabalho tem como objetivo principal, identificar o perfil de mutações no gene APC em famílias do estado do Pará. Um total de 15 pacientes foi analisado provenientes de cinco famílias, todos atendidos no UNACON do HUJBB. Foi realizado a extração de DNA do sangue periférico e realizado um sequenciamento direto em um membro de cada família, obtendo desta forma um screening molecular e os demais membros da família foram genotipados pela técnica ARMS. A análise estatística foi realizada pelos softwares que acompanham o próprio produto. Neste estudo foram encontrados mutações nos 15 membros estudados (provenientes das 5 famílias), 40% das quais eram do tipo frameshift, 35% silenciadoras e 20% nonsense. Sendo que 60% de todas as mutações ocorreram na região MCR. Entre as três mutações mais frequentes na literatura, neste estudo foram encontradas duas: códon 1309 (em 40% dos indivíduos) e no códon 1061 (em 10% dos indivíduos). Estes números foram bem diferentes dos encontrados na literatura, reforçando o papel da miscigenação na frequência das mutações. A mutação c.3956delC foi a única encontrada em todas as famílias analisadas, o que pode comportar-se como um forte biomarcador desta síndrome. A avaliação clínica dos pacientes confirmou a correlação genótipo/fenótipo, sendo um fator determinante para o direcionamento clínico e aconselhamento genético. A plataforma confeccionada para análise de mutações pela técnica ARMS será de grande utilidade, já que conseguiu detectar mutações no 15 indivíduos estudados a um custo bem inferior que o sequenciamento direto por PCR.

Frequent downregulation of the transcription factor Foxa2 in lung cancer through epigenetic silencing

Purpose: We sought to determine the mechanisms of downregulation of the airway transcription factor Foxa2 in lung cancer and the expression status of Foxa2 in non-small-cell lung cancer (NSCLC). Methods: A series of 25 lung cancer cell lines were evaluated for Foxa2 protein expression, FOXA2 mRNA levels, FOXA2 mutations, FOXA2 copy number changes and for evidence of FOXA2 promoter hypermethylation. In addition, 32 NSCLCs were sequenced for FOXA2 mutations and 173 primary NSCLC tumors evaluated for Foxa2 expression using an immunohistochemical assay. Results: Out of the 25 cell lines, 13 (52%) had undetectable FOXA2 mRNA. The expression of FOXA2 mRNA and Foxa2 protein were congruent in 19/22 cells (p = 0.001). FOXA2 mutations were not identified in primary NSCLCs and were infrequent in cell lines. Focal or broad chromosomal deletions involving FOXA2 were not present. The promoter region of FOXA2 had evidence of hypermethylation, with an inverse correlation between FOXA2 mRNA expression and presence of CpG dinucleotide methylation (p < 0.0001). In primary NSCLC tumor specimens, there was a high frequency of either absence (42/173, 24.2%) or no/low expression (96/173,55.4%) of Foxa2. In 130 patients with stage I NSCLC there was a trend towards decreased survival in tumors with no/low expression of Foxa2 (HR of 1.6, 95%CI 0.9-3.1; p = 0.122). Conclusions: Loss of expression of Foxa2 is frequent in lung cancer cell lines and NSCLCs. The main mechanism of downregulation of Foxa2 is epigenetic silencing through promoter hypermethylation. Further elucidation of the involvement of Foxa2 and other airway transcription factors in the pathogenesis of lung cancer may identify novel therapeutic targets. (C) 2012 Elsevier Ireland Ltd. All rights reserved.

NF-κB Drives the Synthesis of Melatonin in RAW 264.7 Macrophages by Inducing the Transcription of the Arylalkylamine-N-Acetyltransferase (AA-NAT) Gene

We demonstrate that during inflammatory responses the nuclear factor kappa B (NF-kappa B) induces the synthesis of melatonin by macrophages and that macrophage-synthesized melatonin modulates the function of these professional phagocytes in an autocrine manner. Expression of a DsRed2 fluorescent reporter driven by regions of the aa-nat promoter, that encodes the key enzyme involved in melatonin synthesis (arylalkylamine-N-acetyltransferase), containing one or two upstream kappa B binding sites in RAW 264.7 macrophage cell lines was repressed when NF-kappa B activity was inhibited by blocking its nuclear translocation or its DNA binding activity or by silencing the transcription of the RelA or c-Rel NF-kappa B subunits. Therefore, transcription of aa-nat driven by NF-kappa B dimers containing RelA or c-Rel subunits mediates pathogen-associated molecular patterns (PAMPs) or pro-inflammatory cytokine-induced melatonin synthesis in macrophages. Furthermore, melatonin acts in an autocrine manner to potentiate macrophage phagocytic activity, whereas luzindole, a competitive antagonist of melatonin receptors, decreases macrophage phagocytic activity. The opposing functions of NF-kappa B in the modulation of AA-NAT expression in pinealocytes and macrophages may represent the key mechanism for the switch in the source of melatonin from the pineal gland to immune-competent cells during the development of an inflammatory response.

Characterization of anti-silencing factor 1 in Leishmania major

Anti-silencing factor 1 (ASF1) is a histone chaperone that contributes to the histone deposition during nucleosome assembly in newly replicated DNA. It is involved in chromatin disassembly, transcription activation and in the cellular response to DNA damage. In Leishmania major the ASF1 gene (LmASF1) is located in chromosome 20 and codes for a protein showing 67% of identity with the Trypanosoma brucei TbASF1a. Compared to orthologous proteins, LmASF1 conserves the main residues relevant for its various biological functions. To study ASF1 in Leishmania we generated a mutant overexpressing LmASF1 in L. major. We observed that the excess of LmASF1 impaired promastigotes growth rates and had no impact on cell cycle progress. Differently from yeast, ASF1 overproduction in Leishmania did not affect expression levels of genes located on telomeres, but led to an upregulation of proteins involved in chromatin remodelling and physiological stress, such as heat shock proteins, oxidoreductase activity and proteolysis. In addition, we observed that LmASF1 mutant is more susceptible to the DNA damaging agent, methyl methane sulphonate, than the control line. Therefore, our study suggests that ASF1 from Leishmania pertains to the chromatin remodelling machinery of the parasite and acts on its response to DNA damage.