987 resultados para Excised Human Skin


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

P>Background The nonclassical human leucocyte antigen (HLA)-G molecule has been well recognized as a tolerogenic molecule and few studies have evaluated the role of the molecule in inflammatory cutaneous autoimmune diseases. Objectives To evaluate the expression of HLA-G in skin specimens of patients with psoriasis and to analyse its correlation with epidemiological and clinical variables. Methods Thirty untreated patients with psoriasis and 32 healthy individuals were enrolled. Immunohistochemistry was applied to identify HLA-G expression in formalin-fixed paraffin-embedded cutaneous skin biopsies. Results Soluble and membrane-bound HLA-G expression was detected in 30 (90%) of the skin specimens from patients presenting clinical and histopathological features of psoriasis. Although infiltrating lymphomononuclear cells of the dermis exhibited HLA-G expression, the epidermis was primarily targeted. HLA-G expression was also observed in 27% (three of 11) of the specimens that exhibited no clinical and histopathological features of psoriasis (nonaffected areas). In contrast, skin specimens obtained from healthy individuals exhibited no HLA-G expression (P < 0 center dot 0001). The intensity of HLA-G expression was not associated with type I/II psoriasis, Psoriasis Area and Severity Index score or clinical forms. Conclusions As the HLA-G molecule was consistently expressed in affected and, to a lesser extent, in nonaffected areas of untreated patients with psoriasis, irrespective of the severity of the clinical variants, one may hypothesize that the presence of HLA-G may be responsible, at least in part, for the regulation of autoimmune effector cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A survey for canine tegumentary leishmaniasis (CTL) has been carried out between 1986 and 1993 in seven endemic localities for American cutaneous leishmaniasis in the State of Rio de Janeiro. 270 dogs have been examined for their clinical aspects, the development of delayed hypersensitivity (DHS) with Immunoleish antigen and with immunofluorescent antibody research of IgG (IF). 28.2% of them had ulcer lesions and 3.3% had scars. The lesions consisted of single (39.5%) and mucocutaneous lesions (31.6%), multiple cutaneous (25.0%) and mucocutaneous lesions associated with cutaneous ulcers (4.0%). Twelve (15.8%) isolates from biopsies were analyzed by zimodeme and schizodeme and identified as L. (V.) braziliensis. The overall prevalence of canine infection that was evaluated with the skin test was of 40.5% and with IF it was of 25.5%. Both tests showed a high positive rate with relation to the animals with mucosal lesions, as in the case of human mucocutaneous leishmaniasis. The comparison of the two tests showed the skin test to have a better performance although there was no statistical difference (p>0.05) between them. The proportional sensitivity and specificity was of 84.0% and 74.0%, respectively. The Immunoleish skin test and IF are useful tools to be employed in CTL field epidemiological surveys.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Spleen cells from mice were examined at 5, 10, 15, 20 and 25 days post-infection (dpi) with Dermatobia hominis larva and at 5, 10, 15, 30 and 60 days post-larval emergence (dple). Cell proliferation in vitro assays were carried out with RPMI-1640 medium and larval secretory product (LSP) of D. hominis at 5, 10, 15, 20 and 25 days. When each group of mice was tested against each medium, significance was only seen for 25 dpi, with increasing order: LSP-10 d, -25 d, -5 d, -20 d, -15 d and RPMI. Significant results were also observed when each medium was tested against mice at each dpi or dple. Each dple group vs. each medium produced significant results only for 10 dple, with increasing order: LSP-5 d, -20 d, -25 d, -10 d, -15 d and RPMI. Comparative tests were also carried out between groups to refine certain observations. The LSPs were also analyzed using SDS-PAGE. The results prove that myiasis caused depletion of spleen cells, particularly under the effect of the LSP-10 and -15, but the cells tended to increase up to 60 dple. This in vitro assay may represent the real systemic immune response in the relationship LSP-D. hominis-host.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

To evaluate the effect of BCG vaccination and T lymphocyte subpopulations on the reactivity to the tuberculin skin test, 113 asymtomatic HIV+ individuals were tuberculin tested by intradermal injection of 5TU of purified protein derivative and the levels of circulating lymphocyte (CD3, CD4 and CD8) subpopulations determined by indirect immunofluorescence. Ninety-two percent of the subjects included in the study were males. The mean age of the group was 32.1±7.4 years. Sixty-two percent presented a BCG scar. However, only 22% exhibited positive tuberculin reactions (³5mm) irrespective of the presence of the BCG scar. Tuberculin positive individuals exhibited higher CD4+ cell counts (p=0.004) and CD4+/CD8+ ratios (p=0.006) than tuberculin negative (<5mm) HIV+ individuals. The number of individuals with positive tuberculin reactions was significantly higher in subjects with more than 500 CD4+ lymphocytes/ml (p=0.02) or CD4+/CD8+ ratios ³1.12 (p=0.002). These results suggest that a prior BCG vaccination does not influence the reactivity to the tuberculin skin test in HIV+ asymptomatic individuals and that the number of CD4+ lymphocytes and the CD4+/CD8+ ratio positively correlate with the tuberculin reactivity

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Localised cutaneous leishmaniasis (LCL) is the most common form of cutaneous leishmaniasis characterised by single or multiple painless chronic ulcers, which commonly presents with secondary bacterial infection. Previous culture-based studies have found staphylococci, streptococci, and opportunistic pathogenic bacteria in LCL lesions, but there have been no comparisons to normal skin. In addition, this approach has strong bias for determining bacterial composition. The present study tested the hypothesis that bacterial communities in LCL lesions differ from those found on healthy skin (HS). Using a high throughput amplicon sequencing approach, which allows for better populational evaluation due to greater depth coverage and the Quantitative Insights Into Microbial Ecology pipeline, we compared the microbiological signature of LCL lesions with that of contralateral HS from the same individuals.Streptococcus, Staphylococcus,Fusobacterium and other strict or facultative anaerobic bacteria composed the LCL microbiome. Aerobic and facultative anaerobic bacteria found in HS, including environmental bacteria, were significantly decreased in LCL lesions (p < 0.01). This paper presents the first comprehensive microbiome identification from LCL lesions with next generation sequence methodology and shows a marked reduction of bacterial diversity in the lesions.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Résumé en français: L'hyperémie réactive dans la microcirculation musculature et cutanée de l'avant-bras permet d'évaluer l'atteinte vasculaire dans les maladie cardiovasculaires. Cette méthode permet d'obtenir un reflet de la progression de l'atteinte vasculaire, de traquer la progression de la maladie ainsi que le risque cardio-vasculaires. Elle est en étude également pour tester l'efficacité d'une intervention thérapeutique. L'hyperémie réactive est dépendante d'une dilatation post ischémique par diminution des résistances artériolaires. Au niveau des membres, l'ischémie peut-être débutée et interrompue très facilement par une manchette à pression gonflée au-dessus de la pression systolique suivie quelques minutes plus tard de son dégonflement. Les mesures de flux sanguin musculaire et cutané au niveau d'un membre sont facile à réaliser chez l'homme, tout particulièrement au niveau de l'avant-bras. Pour l'instant aucune étude utilisant cette approche ne spécifiait quel avant-bras était utilisé. Il est cependant concevable que la réponse varie selon que l'on teste le bras dominant ou non-dominant. Il parait donc important de clarifier ce point. Le premier but de l'étude consiste donc à investiguer une éventuelle différence entre le bras dominant et le bras non-dominant d'un sujet lors de tests de l'hyperémie réactive dans le muscle et la peau. Il est connu que l'hyperémie réactive au niveau musculaire peut-être diminuée par les médicaments antiinflammatoires non stéro~idiens (AINS), indiquant une implication partielle des métabolites de la cyclo-oxygénase. L'influence des AINS sur la réponse cutanée est moins clairement établie. Ainsi, le second but de cette étude est de comparer l'effet de l'inhibition de la cyclo-oxygénase sur l'hyperémie réactive musculaire et cutanée chez des sujets sains. Le collectif de patients consiste en 23 sujets masculins volontaires, en bonne santé, non fumeurs, de 18 à 30 ans. Aucuns antécédents médicaux ne sont connus et aucune médication n'est prise durant la période de l'étude. Tous . les sujets ont donné leur consentement par écrit. Le flux sanguin musculaire de l'avant-bras est mesuré au moyen d'une pléthysmographie par occlusion veineuse, et le flux cutané l'est par imagerie laser Doppler. Les expériences ont lieu entre 16 et 18 h dans une chambre calme à température constante (23-24°C) chez un sujet couché. Les participants n'ont pas consommé d'AINS durant la semaine précédente ni bu de café dans les 12 h précédant l'expérience. Les mesures sont effectuées en triplicat au niveau musculaire puis cutané ou inversement selon un ordre aléatoire. Suite à une occlusion artérielle l'étude du flux se fait sur 3 min et 5 min de récupération sont prises entre 2 mesures. L'expérience 1 consiste à tester un possible effet systématique de la latéralisation du bras dominant ou non sur la réponse à l'hyperémie réactive dans la peau et le muscle de l'avant-bras. 16 sujets sont étudiés à 2 reprises, espacées de 1 à 3 jours. A la première visite, l'hyperémie musculaire est étudiée dans un avant-bras, la réaction cutanée dans l'autre et inversement lors de la deuxième visite. Une précaution est observée afin de mesurer le flux sanguin cutané à la même distance du poignet dans les 2 avant-bras. L'expérience 2 est développée pour évaluer l'impact d'une inhibition des cyclo-oxygénases. Sept sujet sont considérés à 2 occasions espacées de 7 à 10 j. L'étude s'effectue uniquement au niveau de l'avant-bras dominant. Le site cutané au niveau du poignet est marqué lors de la première visite afin d'utiliser le même site de mesure lors de la seconde visite. Le sujet ingère 1,8 g d'Aspegic (équivalant à 1 g d'acide acétylsalilcylique) dissout dans 125 ml de jus d'orange ou le jus d'orange seul lors de l'autre visite selon un ordre randomisé. Les mesures sont débutées 2 h après la prise. Summary Reactive hyperemia (RH) in forearm muscle or skin microcirculation has been considered as a surrogate endpoint in clinical studies of cardiovascular disease. We evaluated two potential confounders that might limit such use of RH, namely laterality of measurement and intake of non-steroidal anti-inflammatory drugs (NSAIDS). Twenty-three young non-smoking healthy adults were enrolled. In Experiment 1 (n=16), the RH elicited by 3 min of ischemia was recorded in the muscle (strain gauge plethysmography, hand excluded) and skin (laser Doppler imaging) of both forearms. In Experiment 2 (n=7), RH was determined in the dominant forearm only, one hour following oral acetylsalicylic acid (1 g) or placebo. In Experiment 1, peak RH was identical in both forearms, and so were the corresponding durations of responses. RH lasted significantly less in muscle than in skin (p=0.003), a hitherto unrecognized fact. In the skin, acetylsalicylate reduced duration (43 vs 57.4 s for placebo, p=0.03), without affecting the peak response. In muscle, duration tended to decrease with acetylsalicylate (21.4 vs 26.0 s with placebo, p=0.06) and the peak increase in blood flow was blunted (27.2 vs 32.4 ml/min/100 ml tissue with placebo, p=0.003). We conclude that, when using RH as a surrogate endpoint in studies of cardiovascular disease, a confounding by laterality of measurement need not be feared, but NSAIDS may have an influence, although perhaps not on the peak response in the skin.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Current restrictions for human cell-based therapies have been related to technological limitations with regards to cellular proliferation capacity (simple culture conditions), maintenance of differentiated phenotype for primary human cell culture and transmission of communicable diseases. Cultured primary fetal cells from one organ donation could possibly meet the exigent and stringent technical aspects for development of therapeutic products. Master and working cell banks from one fetal organ donation (skin) can be developed in short periods of time and safety tests can be performed at all stages of cell banking. For therapeutic use, fetal cells can be used up to two thirds of their life-span in an out-scaling process and consistency for several biological properties includes protein concentration, gene expression and biological activity. As it is the intention that banked primary fetal cells can profit from the prospected treatment of hundreds of thousands of patients with only one organ donation, it is imperative to show consistency, tracability and safety of the process including donor tissue selection, cell banking, cell testing and growth of cells in out-scaling for the preparation of whole-cell tissue-engineering products.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MTT assay and uptake of the vital dye neutral red 24 h after dosing (NRU). Results. Lysine-derivative surfactants showed higher IC50s than did commercial anionic irritant compounds such as sodium dodecyl sulphate, proving to be no more harmful than amphoteric betaines. The aggressiveness of the surfactants depended upon the size of their constituent counterions: surfactants associated with lighter counterions showed a proportionally higher aggressivity than those with heavier ones. Conclusions. Synthetic lysine-derivative anionic surfactants are less irritant than commercial surfactants such as sodium dodecyl sulphate and Hexadecyltrimethylammonium bromide and are similar to Betaines. These surfactants may offer promising applications in pharmaceutical and cosmetic preparations, representing a potential alternative to commercial anionic surfactants as a result of their low irritancy potential.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

L'hyperhémie réactive, définie comme l'augmentation transitoire du flux sanguin après une courte période d'ischémie, pourrait être influencée par des vasoconstricteurs de la famille des prostanoïdes, telle que la thromboxane. Le terutroban (S18886) est un antagoniste spécifique des récepteurs à la thromboxane. L'étude présentée a cherché à déterminer l'effet du terutroban sur l'hyperhémie réactive dans la peau et le muscle squelettique de l'avant-bras de volontaires sains. Vingt volontaires sains ont été randomisés en aveugle pour recevoir oralement 30mg/j de terutroban ou un placebo pendant 5 jours puis réciproquement pendant une deuxième période de 5 jours, selon un schéma cross-over. L'ischémie transitoire a été provoquée par l'occlusion de l'artère brachiale par une manchette gonflée au dessus de la pression systolique. L'hyperhémie réactive était évaluée dans les tissus de l'avant- bras, en mesurant le flux sanguin, pour la peau par une méthode laser Doppler, et pour le muscle au moyen d'une pléthysmographie par jauge de contrainte durant une occlusion veineuse. Au premier et au dernier jour de chaque période de traitement, l'hyperhémie réactive était mesurée avant et 2 heures après l'ingestion du comprimé. Que ce soit dans la peau ou le muscle, le terutroban n'a pas montré d'effet sur le flux de pic post-occlusion ni sur la réponse globale d'hyperhémie, exprimée en aire sous la courbe. En conclusion, dans la peau et le muscle de sujets sains, l'hypérémie réactive n'est pas influencée par les récepteurs spécifiques à la thromboxane.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Substance P (SP), an undecapeptide belonging to the tachykinin family, is released during the activation of sensory nerves, and causes vasodilation, edema and pain through activation of tissular Neurokinin 1 receptors. SP proinflammatory effects are terminated by angiotensin converting enzyme (ACE) and neutral endopeptidase (NEP), while the aminopeptidase dipeptidylpeptidase IV (DPPIV) can also play a role. The aim of this randomized, crossover, double-blind study was to assess the cutaneous vasoreactivity (flare and wheal reaction, burning pain sensation) to intradermal injection of ascending doses of SP in six volunteers receiving a single therapeutic dose of the DPPIV inhibitor sitagliptin or a matching placebo. Cutaneous SP challenges produced the expected, dose-dependent flare and wheal response, while eliciting mild to moderate local pain sensation with little dose dependency. However, no differences were shown in the responses observed under sitagliptin compared with placebo, while the study would have been sufficiently powered to detect a clinically relevant increase in sensitivity to SP. The results of this pilot study are in line with proteolytic cleavage of SP by ACE and NEP compensating the blockade of DPPIV to prevent an augmentation of its proinflammatory action.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In order to investigate herpesvirus (HHV) role in the susceptibility to skin cancer, we compared HHV6 and HHV1 incidence in DNA samples extracted from 120 lesions and 41 normal skin tissues. HHV6 (31.7%) and HHV1 (23.8%) were detected more frequently in skin cancer than in control individuals (14.6 and 5%, respectively) (P=0.0391 and P=0.00094, respectively). The risk of presenting basal cell carcinomas (BCC) was more than 3 times higher for HHV-6 infected patients (OR=3.182; 95% CI: 1.125-8.997). The risk for HHV-1 infected individuals of presenting BCC and squamous cell carcinomas was increased 8 and 6 times, respectively (OR=8.125; 95% CI: 1.735-38.043 and OR=6.290; 95% CI: 1.283-30.856, respectively). (c) 2004 Elsevier B.V.. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

P>BackgroundThe nonclassical human leucocyte antigen (HLA)-G molecule has been well recognized as a tolerogenic molecule and few studies have evaluated the role of the molecule in inflammatory cutaneous autoimmune diseases.ObjectivesTo evaluate the expression of HLA-G in skin specimens of patients with psoriasis and to analyse its correlation with epidemiological and clinical variables.MethodsThirty untreated patients with psoriasis and 32 healthy individuals were enrolled. Immunohistochemistry was applied to identify HLA-G expression in formalin-fixed paraffin-embedded cutaneous skin biopsies.ResultsSoluble and membrane-bound HLA-G expression was detected in 30 (90%) of the skin specimens from patients presenting clinical and histopathological features of psoriasis. Although infiltrating lymphomononuclear cells of the dermis exhibited HLA-G expression, the epidermis was primarily targeted. HLA-G expression was also observed in 27% (three of 11) of the specimens that exhibited no clinical and histopathological features of psoriasis (nonaffected areas). In contrast, skin specimens obtained from healthy individuals exhibited no HLA-G expression (P < 0 center dot 0001). The intensity of HLA-G expression was not associated with type I/II psoriasis, Psoriasis Area and Severity Index score or clinical forms.ConclusionsAs the HLA-G molecule was consistently expressed in affected and, to a lesser extent, in nonaffected areas of untreated patients with psoriasis, irrespective of the severity of the clinical variants, one may hypothesize that the presence of HLA-G may be responsible, at least in part, for the regulation of autoimmune effector cells.