Efeito do fator de crescimento IGF-I sobre a maturação in vitro de oócitos caninos (Canis familiaris): avaliação da maturação nuclear e citoplasmática

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Concentrações plasmáticas de testosterona e fertilidade de machos caprinos das raças Boer e Alpina durante as estações reprodutiva e não reprodutiva

Pós-graduação em Medicina Veterinária - FCAV

Eficiência de diferentes doses de acetato de fertirelina na sincronização da emergência da onda folicular e indução da ovulação em vacas leiteiras

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Viabilidade espermática e geração de metabólicos reativos do oxigênio(ROS) no sêmen ovino criopreservado em diluidor aditivado de lauril de sódio (OE), trolox-C e catalase

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Variabilidade das sub-populações de espermatozóides avaliados pela cinética em sistema computadorizado e combinação de sondas fluorescentes como praâmetro quantitativo do sêmen congelado de ovinos

Pós-graduação em Medicina Veterinária - FMVZ

Análise do risco da ocorrência da síndrome reprodutiva e respiratória dos suínos(PRRS) em granjas de suínos tecnificadas do Estado de São Paulo: estudo do perfil descritivo da situação atual

Pós-graduação em Medicina Veterinária - FMVZ

Criopreservação e fertilidade de espermatozoides do ejaculado e recuperados da cauda do epidídimo de garanhões subférteis

Pós-graduação em Medicina Veterinária - FMVZ

Reproductive parameters of dairy goats submitted to estrus synchronization with prostaglandin F2α associated or not to hCG at estrous onset

O objetivo deste estudo foi avaliar a eficiência do uso de duas doses de PGF associadas ou não à administração de hCG no início do estro sobre os parâmetros reprodutivos de cabras leiteiras. Um total de 29 cabras receberam duas doses de 30 µg d-cloprostenol pela via latero-vulvar com 10 dias de intervalo (Dia 1 e Dia 10). As cabras foram alocadas para receberem o hCG (250 IU) ou salina i.m. no momento em que o estro foi detectado. Depois da realização da segunda dose de PGF, o estro foi monitorado e exames ultrassonográficos foram realizados duas vezes ao dia. Todas as fêmeas foram inseminadas 16 h após o inicio do estro. Amostras de sangue foram coletadas diariamente para determinação das concentrações plasmáticas de progesterona. O uso do hCG no momento do início do estro não afetou os parâmetros estudados e, portanto, os dados serão apresentados agrupados. A taxa de manifestação de estro foi similar (P > 0,05) na primeira (75,9% - 22/29) ou na segunda dose de PGF (79,3% - 23/29). O intervalo entre a administração de PGF e o início do estro foi maior (P < 0,05) no Dia 1 (75,8±53,9 h) que no Dia 10 (47,7±10,1 h). Duração do estro também diferiu (P < 0,05) 35,4±15,9 (Dia 1) vs 26,8±15, 0 h (Dia 10). A taxa de ovulação foi 79,3% (23/29) após a segunda dose PGF. Não foi encontrada diferença (P>0,05) entre os grupos experimentais quanto aos parâmetros reprodutivos: intervalo entre a aplicação da segunda dose e a ovulação (86,6±11,4h), intervalo do estro a ocorrência da ovulação (39,9±12,3h), diâmetro do maior folículo (7,2±1,4) e número de ovulações (1,8±0,6). No Dia 1, 52,4% (11/21) apresentavam concentrações de progesterona < 1 ng/mL. No Dia 10, 100% dos animais apresentavam concentrações >1ng/mL. O presente estudo permite concluir que o estro pode ser eficientemente sincronizado em cabras leiteiras com duas doses de PGF intervaladas em 10 dias. Novas pesquisas devem se realizadas para avaliar diferentes doses e momentos de utilização do hCG.

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Análise de parâmetros espermáticos e fertilidade de ratos Wistar expostos ao interferon alfa

Pós-graduação em Biologia Geral e Aplicada - IBB

Embriões bovinos produzidos in vitro com espermatozoides sexados por citometria de fluxo: avaliação do desenvolvimento embrionário e da expressão de genes candidatos ao reconhecimento da gestação

Pós-graduação em Genética e Melhoramento Animal - FCAV

Resposta luteal à PGF2α (Dinoprost Trometamina) durante as fases de luteogênese e manutenção do corpo lúteo em éguas

Pós-graduação em Medicina Veterinária - FMVZ

Inducing ovulation early postpartum influences uterine health and fertility in dairy cows

The objective of the current study was to evaluate the effect of GnRH early postpartum on induction of ovulation, uterine health, and fertility in dairy cows. Holstein cows without a corpus luteum (CL) at 17 +/- 3 DIM were assigned randomly to receive i.m. GnRH (n = 245) at 17 +/- 3 and 20 +/- 3 DIM or remain as controls (n = 245). Ovaries were scanned by ultrasonography twice weekly totaling 4 examinations. Ovulation was characterized by the appearance of a CL >= 20 mm at any ultrasound or CL <20 mm in 2 consecutive examinations. Clinical and cytological endometritis were diagnosed at 35 DIM. Compared with control, GnRH increased ovulation up to 3.5 d after the last treatment (78.7 vs. 45.0%) and did not affect the prevalence of clinical endometritis (23.9 vs. 18.6%) or cytological endometritis (30.9 vs. 32.8%). Prevalence of clinical endometritis increased in cows that had calving problems (32.6 vs. 15.9%) and metritis (40.6 vs. 15.8%). Metritis increased prevalence of cytological endometritis (50.7 vs. 23.5%). Treatment with GnRH did not affect pregnancy per artificial insemination at 32 (37.6 vs. 38.6%) or 74 d after artificial insemination (35.0 vs. 31.5%), but reduced pregnancy loss (6.8 vs. 18.1%). No overall effect of GnRH treatment on hazard of pregnancy was observed; however, an interaction between GnRH treatment and ovulation showed that GnRH-treated cows that ovulated had increased hazard of pregnancy by 300 DIM compared with GnRH-treated and control cows that did not ovulate (hazard ratio = 2.0 and 1.3, respectively), but similar to control cows that ovulated (hazard ratio = 1.1). Gonadotropin-releasing hormone early postpartiim induced ovulation without affecting uterine health, but failed to improve pregnancy per artificial insemination or time to pregnancy, although it reduced pregnancy loss.

Impacts of Reproductive Technologies on Beef Production in South America

The majority of beef cow herds in South America are constituted by Bos indicus females, which have particular reproductive features that contribute to reduced reproductive efficiency compared with that of B. taurus cohorts. Hence, several alternatives to enhance reproductive efficiency of B. indicus heifers and cows have been developed to address their inherent reproductive shortcomings. These research-based technologies are being described in detail within this chapter and have already made an impact on South American B. indicus-based production systems. These include the following: (a) hormonal protocols to induce puberty in nulliparous heifers or estrous cyclicity in postpartum cows to maximize their reproductive performance during the subsequent breeding season, (b) hormonal protocols to synchronize estrus and/or ovulation in B. indicus females to exploit their reproductive responses to artificial insemination, and (c) genetic and environmental factors that influence reproductive success in beef herds, including reproductive diseases and excitable temperament of B. indicus females, that have been investigated to support/promote the development of appropriate mitigation technologies.