Insulin-like growth factor I treatment reduces demyelination and up-regulates gene expression of myelin-related proteins in experimental autoimmune encephalomyelitis.

To compare effects of insulin-like growth factor I (IGF-I) and placebo treatment on lesions that resemble those seen during active demyelination in multiple sclerosis, we induced experimental autoimmune encephalomyelitis in Lewis rats with an emulsion containing guinea pig spinal cord and Freund's adjuvant. On day 12-13, pairs of rats with the same degree of weakness were given either IGF-I or placebo intravenously twice daily for 8 days. After 8 days of placebo or IGF-I (200 micrograms/day or 1 mg/day) treatment, the spinal cord lesions were studied by in situ hybridization and with immunocytochemical and morphological methods. IGF-I produced significant reductions in numbers and areas of demyelinating lesions. These lesions contained axons surrounded by regenerating myelin segments instead of demyelinated axons seen in the placebo-treated rats. Relative mRNA levels for myelin basic protein, proteolipid protein (PLP), and 2',3'-cyclic nucleotide 3'-phosphodiesterase in lesions of IGF-I-treated rats were significantly higher than they were in placebo-treated rats. PLP mRNA-containing oligodendroglia also were more numerous and relative PLP mRNA levels per oligodendrocyte were higher in lesions of IGF-I-treated rats. Finally, a significantly higher proportion of proliferating cells were oligodendroglia-like cells in lesions of IGF-I-treated rats. We think that IGF-I effects on oligodendrocytes, myelin protein synthesis, and myelin regeneration reduced lesion severity and promoted clinical recovery in this experimental autoimmune encephalomyelitis model. These IGF-I actions may also benefit patients with multiple sclerosis.

A 5'-upstream region of a bovine keratin 6 gene confers tissue-specific expression and hyperproliferation-related induction in transgenic mice.

Keratins, the constituents of epithelial intermediate filaments, are precisely regulated in a tissue- and development-specific manner, although little is known about the molecular mechanisms underlying this regulation. The expression pattern of keratin 6 is particularly complex, since besides being constitutively expressed in hair follicles and in suprabasal cells of a variety of internal stratified epithelia, it is induced in epidermis in both natural and artificially caused hyperproliferative situations. Therefore, the regulatory sequences controlling keratin 6 gene activity are particularly suitable for target gene expression in a tissue-specific manner. More interestingly, they can be skin-induced in transgenic animals or in gene therapy protocols, particularly those addressing epidermal hyperproliferative disorders. To delimit the regions containing these regulatory elements, different parts of the bovine keratin 6 gene linked to a beta-galactosidase reporter gene have been assayed in transgenic mice. A 9-kbp fragment from the 5' upstream region was able to provide both suprabasal tissue-specific and inducible reporter expression.

Disruption of the gene for hsp30, an alpha-crystallin-related heat shock protein of Neurospora crassa, causes defects in thermotolerance.

The alpha-crystallin-related heat shock proteins are produced by all eukaryotes, but the role of these proteins in thermoprotection remains unclear. To investigate the function of one of these proteins, we disrupted expression of the single-copy hsp30 gene of Neurospora crassa, using repeat-induced point mutagenesis, and we generated and characterized mutant strains that were deficient in hsp30 synthesis. These strains could grow at high temperature and they acquired thermotolerance from a heat shock. However, the hsp30-defective strains proved to be extremely sensitive to the combined stresses of high temperature and carbohydrate limitation, enforced by the addition of a nonmetabolizable glucose analogue. Under these conditions, their survival was reduced by 90% compared with wild-type cells. This sensitive phenotype was reversed by reintroduction of a functional hsp30 gene into the mutant strains. The mutant cells contained mitochondria from which a 22-kDa protein was readily extracted with detergents, in contrast to its retention by the mitochondria of wild-type cells. Antibodies against hsp30 coimmunoprecipitated a protein also of approximately 22 kDa from wild-type cells. Results of this study suggest that hsp30 may be important for efficient carbohydrate utilization during high temperature stress and that it may interact with other mitochondrial membrane proteins and function as a protein chaperone.

The disease-resistance gene Pto and the fenthion-sensitivity gene fen encode closely related functional protein kinases.

Resistance to bacterial speck in tomato is governed by a gene-for-gene interaction in which a single resistance locus (Pto) in the plant responds to the expression of a specific avirulence gene (avrPto) in the pathogen. Disease susceptibility results if either Pto or avrPto are lacking from the corresponding organisms. Leaves of tomato cultivars that contain the Pto locus also exhibit a hypersensitive-like response upon exposure to an organophosphorous insecticide, fenthion. Recently, the Pto gene was isolated by a map-based cloning approach and was shown to be a member of a clustered multigene family with similarity to various protein-serine/threonine kinases. Another member of this family, termed Fen, was found to confer sensitivity to fenthion. The Pto protein shares 80% identity (87% similarity) with Fen. Here, Pto and Fen are shown to be functional protein kinases that probably participate in the same signal transduction pathway.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

International Union of Pharmacology. LXIX. Status of the calcitonin gene-related peptide subtype 2 receptor

Historically, calcitonin gene-related peptide (CGRP) receptors have been divided into two classes, CGRP(1) and CGRP(2).After the cloning of calcitonin receptor-like receptor (CLR) and receptor activity-modifying proteins (RAMPs), it became clear that the CGRP(1) receptor was a complex between CLR and RAMP1. It is now apparent that the CGRP(2) receptor phenotype is the result of CGRP acting at receptors for amylin and adrenomedullin. Accordingly, the term "CGRP(2)" receptor should no longer be used, and the "CGRP(1)" receptor should be known as the "CGRP" receptor.

Characterization and effects on cAMP accumulation of adrenomedullin and calcitonin gene-related peptide (CGRP) receptors in dissociated rat spinal cord cell culture

1 Adrenomedullin (AM) and calcitonin gene-related peptide (CGRP) have structural similarities, interact with each others receptors (calcitonin receptor-like receptor (CLR)/receptor-activity-modifying proteins (RAMPs)) and show overlapping biological activities. AM and CGRP receptors are chiefly coupled to cAMP production. In this study, a method of primary dissociated cell culture was used to investigate the presence of AM and CGRP receptors and their effects on cAMP production in embryonic spinal cord cells. 2 Both neuronal and non-neuronal CLR immunopositive cells were present in our model. 3 High affinity, specific [ 125I]-AM binding sites (K(d) 79±9 pM and B(max) 571±34 fmol mg -1 protein) were more abundant than specific [ 125I]-CGRP binding sites (K(d) 12±0.7 pM and B(max) 32±2 fmol mg -1 protein) in embryonic spinal cord cells. 4 Specific [ 125I]-AM binding was competed by related molecules with a ligand selectivity profile of rAM>hAM(22-52)>rCGRPα>CGRP(8-37) ≫[r-(r*,s*)]-N-[2-[[5-amino-1-[[4-(4-pyridinyl)-1-piperazinyl] carbonyl]pentyl]amino]-1-[(3,5-dibromo-4-hydroxyphenyl)methyl]-2-oxoethyl]-4-(1, 4-dihydro-2-oxo-3(2H)-quinazolinyl)-,1-piperidinecarboxamide (BIBN4096BS). 5 Specific [ 125I]-CGRP binding was competed by rCGRPα>rAM≥ CGRP(8-37)≥BIBN4096BS>hAM(22-52). 6 Cellular levels of cAMP were increased by AM (pEC"5"0 10.2±0.2) and less potently by rCGRPα (pEC"5"0 8.9±0.4). rCGRPα-induced cAMP accumulation was effectively inhibited by CGRP(8-37) (pA"2 7.63±0.44) and hAM(22-52) (pA"2 6.18±0.21) while AM-stimulation of cAMP levels was inhibited by CGRP(8-37) (pA"2 7.41±0.15) and AM(22-52) (pA"2 7.26±0.18). BIBN4096BS only antagonized the effects of CGRP (pA"2 8.40±0.30) on cAMP accumulation. 7 These pharmacological profiles suggest that effects of CGRP are mediated by the CGRP"1 (CLR/RAMP1) receptor in our model while those of AM are related to the activation of the AM"1 (CLR/RAMP2) receptor subtype. © 2006 Nature Publishing Group All rights reserved.

The second intracellular loop of the calcitonin gene-related peptide receptor provides molecular determinants for signal transduction and cell surface expression

The calcitonin gene-related peptide (CGRP) receptor is a heterodimer of a family B G-protein-coupled receptor, calcitonin receptor-like receptor (CLR), and the accessory protein receptor activity modifying protein 1. It couples to Gs, but it is not known which intracellular loops mediate this. We have identified the boundaries of this loop based on the relative position and length of the juxtamembrane transmembrane regions 3 and 4. The loop has been analyzed by systematic mutagenesis of all residues to alanine, measuring cAMP accumulation, CGRP affinity, and receptor expression. Unlike rhodopsin, ICL2 of the CGRP receptor plays a part in the conformational switch after agonist interaction. His-216 and Lys-227 were essential for a functional CGRP-induced cAMP response. The effect of (H216A)CLR is due to a disruption to the cell surface transport or surface stability of the mutant receptor. In contrast, (K227A)CLR had wild-type expression and agonist affinity, suggesting a direct disruption to the downstream signal transduction mechanism of the CGRP receptor. Modeling suggests that the loop undergoes a significant shift in position during receptor activation, exposing a potential G-protein binding pocket. Lys-227 changes position to point into the pocket, potentially allowing it to interact with bound G-proteins. His-216 occupies a position similar to that of Tyr-136 in bovine rhodopsin, part of the DRY motif of the latter receptor. This is the first comprehensive analysis of an entire intracellular loop within the calcitonin family of G-protein-coupled receptor. These data help to define the structural and functional characteristics of the CGRP-receptor and of family B G-protein-coupled receptors in general. © 2006 by The American Society for Biochemistry and Molecular Biology, Inc.

Interaction of calcitonin-gene-related peptide with its receptors

The receptor for calcitonin-gene-related peptide (CGRP) is a heterodimer formed by calcitonin-receptor-like receptor (CRLR), a type II (family B) G-protein-coupled receptor, and receptor-activity-modifying protein 1 (RAMP1), a single-membrane-pass protein. It is likely that the first seven or so amino acids of CGRP (which form a disulphide-bonded loop) interact with the transmembrane domain of CRLR to cause receptor activation. The rest of the CGRP molecule falls into three domains. Residues 28-37 and 8-18 are normally required for high-affinity binding, while residues 19-27 form a hinge region. The 28-37 region is almost certainly in direct contact with the receptor; 8-18 may make additional receptor contacts or may stabilize an appropriate conformation of 28-37. It is likely that these regions of CGRP interact both with CRLR and with the extracellular domain of RAMP1.

International Union of Pharmacology. XXXII. The mammalian calcitonin gene-related peptides, adrenomedullin, amylin, and calcitonin receptors

The calcitonin family of peptides comprises calcitonin, amylin two calcitonin gene-related peptides (CGRPs), and adrenomedullin. The first calcitonin receptor was cloned in 1991. Its pharmacology is complicated by the existence of several splice variants. The receptors for the other members the family are made up of subunits. The calcitonin-like receptor (CL receptor) requires a single transmembrane domain protein, termed receptor activity modifying protein, RAMP1, to function as a CGRP receptor. RAMP2 and -3 enable the same CL receptor to behave as an adrenomedullin receptor. Although the calcitonin receptor does not require RAMP to bind and respond to calcitonin, it can associate with the RAMPs, resulting in a series of receptors that typically have high affinity for amylin and varied affinity for CGRP. This review aims to reconcile what is observed when the receptors are reconstituted in vitro with the properties they show in native cells and tissues. Experimental conditions must be rigorously controlled because different degrees of protein expression may markedly modify pharmacology in such a complex situation. Recommendations, which follow International Union of Pharmacology guidelines, are made for the nomenclature of these multimeric receptors.

Characterization of receptors for calcitonin gene-related peptide and adrenomedullin on the guinea-pig vas deferens

1. The receptors which mediate the effects of calcitonin gene-related peptide (CGRP), amylin and adrenomedullin on the guinea-pig vas deferens have been investigated. 2. All three peptides cause concentration dependant inhibitions of the electrically stimulated twitch response (pD 2s for CGRP, amylin and adrenomedullin of 7.90 ± 0.11, 7.70 ± 0.19 and 7.25 ± 0.10 respectively). 3. CGRP 8-37 (1 μM) and AC187 (10 μM) showed little antagonist activity against adrenomedullin. 4. Adrenomedullin 22-52 by itself inhibited the electrically stimulated contractions of the vas deferens and also antagonized the responses to CGRP, amylin and adrenomedullin. 5. [ 125I]-adrenomedullin labelled a single population of binding sites in vas deferens membranes with a pIC 50 of 8.91 and a capacity of 643 fmol mg -1. Its selectivity profile was adrenomedullin > AC187 > CGRP = amylin. It was clearly distinct from a site labelled by [ 125I]-CGRP (pIC 50 = 8.73, capacity = 114 fmol mg -1, selectivity CGRP > amylin = AC187 > adrenomedullin). [ 125I]-amylin bound to two sites with a total capacity of 882 fmol mg -1. 6. Although CGRP has been shown to act at a CGRP 2 receptor on the vas deferens with low sensitivity to CGRP 8-37, this antagonist displaced [ 125I]-CGRP with high affinity from vas deferens membranes. This affinity was unaltered by increasing the temperature from 4°C to 25°C, suggesting the anomalous behaviour of CGRP 8-37 is not due to temperature differences between binding and functional assays.

Multiple receptors for calcitonin gene-related peptide and amylin on guinea-pig ileum and vas deferens

1. The responses of the electrically stimulated guinea-pig ileum and vas deferens to human and rat calcitonin gene-related peptide (CGRP) and amylin were investigated. 2. The inhibition of contraction of the ileum produced by human alpha CGRP was antagonized by human alpha CGRP8-37 (apparent pA2 estimated at 7.15 +/- 0.23) > human alpha CGRP19-37 (apparent pA2 estimated as 6.67 +/- 0.33) > [Tyr0]-human alpha CGRP28-37. The amylin antagonist, AC187, was three fold less potent than CGRP8-37 in antagonizing human alpha CGRP. 3. Both human beta- and rat alpha CGRP inhibited contractions of the ileum, but this was less sensitive to inhibition by CGRP8-37 than the effect of human alpha CGRP. However, CGRP19-37 was twenty times more effective in inhibiting the response to rat alpha CGRP (apparent pA2 estimated as 8.0 +/- 0.1) compared to human alpha CGRP. 4. Rat amylin inhibited contractions in about 10% of ileal preparations; this effect was not antagonized by any CGRP fragment. Human amylin had no action on this preparation. 5. Both human and rat alpha CGRP inhibited electrically stimulated contractions of the vas deferens, which were not antagonized by 3 microM CGRP8-37 or 10 microM AC187. 6. Rat amylin inhibited the stimulated contractions of the vas deferens (EC50 = 77 +/- 9 nM); human amylin was less potent (EC50 = 213 +/- 22 nM). The response to rat amylin was antagonized by 10 microM CGRP8-37 (EC50 = 242 +/- 25 nM) and 10 microM AC187 (EC50 = 610 +/- 22 nM). 7. It is concluded that human alpha CGRP relaxes the guinea-pig ileum via CGRP1-like receptors, but that human beta CGRP and rat alpha CGRP may use additional receptors. These are distinct CGRP2-like and amylin receptors on guinea-pig vas deferens.

Pharmacological characterization of a receptor for calcitonin gene-related peptide on rat, L6 myocytes

1 The L6 myocyte cell line expresses high affinity receptors for calcitonin gene-related peptide (CGRP) which are coupled to activation of adenylyl cyclase. The biochemical pharmacology of these receptors has been examined by radioligand binding or adenosine 3':5'-cyclic monophosphate (cyclic AMP) accumulation. 2 In intact cells at 37 degrees C, human and rat alpha- and beta-CGRP all activated adenylyl cyclase with EC50s of about 1.5 nM. A number of CGRP analogues containing up to five amino acid substitutions showed similar potencies. In membrane binding studies at 22 degrees C in 1 mM Mg2+, the above all bound to a single site with IC50s of 0.1-0.4 nM. 3 The fragment CGRP(8-37) acted as a competitive antagonist of CGRP stimulation of adenylyl cyclase with a calculated Kd of 5 nM. The Kd determined in membrane binding assays was lower (0.5 nM). 4 The N-terminal extended human alpha-CGRP analogue Tyro-CGRP activated adenylyl cyclase and inhibited [125I]-iodohistidyl-CGRP binding less potently than human alpha-CGRP (EC50 for cyclase = 12 nM, IC50 for binding = 4 nM). 5 The pharmacological profile of the L6 CGRP receptor suggests that it most closely resembles sites on skeletal muscle, cardiac myocytes and hepatocytes. The L6 cell line should be a stable homogeneous model system in which to study CGRP mechanisms and pharmacology."