975 resultados para enzyme-linked immunosorbent assay (ELISA)


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed to determine the effects of different concentrations of propofol (2,6-diisopropylphenol) on lipopolysaccharide (LPS)-induced expression and release of high-mobility group box 1 protein (HMGB1) in mouse macrophages. Mouse macrophage cell line RAW264.7 cells were randomly divided into 5 treatment groups. Expression levels of HMGB1 mRNA were detected using RT-PCR, and cell culture supernatant HMGB1 protein levels were detected using enzyme-linked immunosorbent assay (ELISA). Translocation of HMGB1 from the nucleus to the cytoplasm in macrophages was observed by Western blotting and activity of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in the nucleus was detected using ELISA. HMGB1 mRNA expression levels increased significantly in the cell culture supernatant and in cells after 24 h of stimulating RAW264.7 cells with LPS (500 ng/mL). However, HMGB1 mRNA expression levels in the P2 and P3 groups, which received 500 ng/mL LPS with 25 or 50 μmol/mL propofol, respectively, were significantly lower than those in the group receiving LPS stimulation (P<0.05). After stimulation by LPS, HMGB1 protein levels were reduced significantly in the nucleus but were increased in the cytoplasm (P<0.05). Simultaneously, the activity of NF-κB was enhanced significantly (P<0.05). After propofol intervention, HMGB1 translocation from the nucleus to the cytoplasm and NF-κB activity were inhibited significantly (each P<0.05). Thus, propofol can inhibit the LPS-induced expression and release of HMGB1 by inhibiting HMGB1 translocation and NF-κB activity in RAW264.7 cells, suggesting propofol may be protective in patients with sepsis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Liver fibrosis occurring as an outcome of non-alcoholic steatohepatitis (NASH) can precede the development of cirrhosis. We investigated the effects of sorafenib in preventing liver fibrosis in a rodent model of NASH. Adult Sprague-Dawley rats were fed a choline-deficient high-fat diet and exposed to diethylnitrosamine for 6 weeks. The NASH group (n=10) received vehicle and the sorafenib group (n=10) received 2.5 mg·kg-1·day-1 by gavage. A control group (n=4) received only standard diet and vehicle. Following treatment, animals were sacrificed and liver tissue was collected for histologic examination, mRNA isolation, and analysis of mitochondrial function. Genes related to fibrosis (MMP9, TIMP1, TIMP2), oxidative stress (HSP60, HSP90, GST), and mitochondrial biogenesis (PGC1α) were evaluated by real-time quantitative polymerase chain reaction (RT-qPCR). Liver mitochondrial oxidation activity was measured by a polarographic method, and cytokines by enzyme-linked immunosorbent assay (ELISA). Sorafenib treatment restored mitochondrial function and reduced collagen deposition by nearly 63% compared to the NASH group. Sorafenib upregulated PGC1α and MMP9 and reduced TIMP1 and TIMP2 mRNA and IL-6 and IL-10 protein expression. There were no differences in HSP60, HSP90 and GST expression. Sorafenib modulated PGC1α expression, improved mitochondrial respiration and prevented collagen deposition. It may, therefore, be useful in the treatment of liver fibrosis in NASH.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Abstract Bovine Spongiform Encephalopathy (BSE) is a virulent disease which may infect by affecting the central nervous system (CNS) tissues in cattle and causes degeneration in nerves. Central nervous system tissues such as brain and spinal cord which are classified as specified risk materials (SRMs) are regarded to be main source of infection. The contamination of the meat with the specific risk materials (SRMs) can occur in phases of slaughter, fragmentation of carcass and processing. This study was conducted in order to investigate the existence of CNS tissues in raw meat ball (cig kofte) which is commonly consumed in the Southeastern Region of Turkey, particularly in Şanlıurfa. For this purpose, 145 samples of raw meat ball were tested. The enzyme-linked immunosorbent assay (ELISA) kits (Ridascreen risk material 10/5, R-biofarm GmbH) which determine glial fibrillary acidic protein (GFAP) as determinant were used. As a result of the analyses, positivity was detected in 21 of totally 145 samples of raw meat ball (14.48%). 6 (4.14%) of the samples gave low level of positivity (≥ 0.1 standard absorbance), 10 (6.90%) gave medium level of positivity (>0.2 standard absorbance) and 5 (3.45%) gave high level of positivity (≥0.5 standard absorbance). As a consequence, meats are contaminated in any phase of both slaughter and meat production even if accidentally. Regarding this matter, necessary measures should be taken and hygiene rules should be applied.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: Peroxynitrite (ONOO-) is formed in the inflamed and degenerating human joint. Peroxynitrite-modified collagen-II (PMC-II) was recently discovered in the serum of patients with osteoarthritis (OA) and rheumatoid arthritis (RA). Therefore we investigated the cellular effects of PMC-II on human mesenchymal progenitor cells (MPCs) as a model of cartilage and cartilage repair cells in the inflamed and degenerating joint. Design: MPCs were isolated from the trabecular bone of patients undergoing reconstructive surgery and were differentiated into a chondrogenic lineage. Cells were exposed to PMC-II and levels of the proinflammatory mediators nitric oxide (NO) and prostaglandin E-2 (PGE(2)) measured. Levels of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2), phosphorylated mitogen activated protein kinases (MAPKs) and nuclear factor kappa B (NF-kappa B) activation were measured by enzyme linked immunosorbent assay (ELISA) together with specific MAPK and NF-kappa B inhibitors. Results: PMC-II induced NO and PGE(2) synthesis through upregulation of iNOS and COX-2 proteins. PMC-II also lead to the phosphorylation of MAPKs, extracellularly regulated kinase 1/2 (ERK1/2) and p38 [but not c-Jun NH2-terminal kinase (JNK1/2)] and the activation of proinflammatory transcription factor NF-kappa B. Inhibitors of p38, ERK1/2 and NF-kappa B prevented PMC-II induced NO and PGE(2) synthesis, NOS and COX-2 protein expression and NF-kappa B activation. Conclusion: iNOS, COX-2, NF-KB and MAPK are known to be activated in the joints of patients with OA and RA. PMC-II induced iNOS and COX-2 synthesis through p38, ERK1/2 and NF-KB dependent pathways suggesting a previously unidentified pathway for the synthesis of the proinflammatory mediators, NO and PGE(2), further suggesting that inhibitors of these pathways may be therapeutic in the inflamed and degenerating human joint. (c) 2005 OsteoArthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background and Objective: Cytolethal distending toxin (CDT) is a genotoxin produced by Aggregatibacter actinomycetemcomitans. In spite of its association with pathogenesis, little is known about the humoral immune response against the CDT. This study aimed to test whether subgingival colonization and humoral response to A. actinomycetemcomitans would lead to a response against CDT. Material and Methods: Sera from periodontally healthy, localized and generalized aggressive periodontitis and chronic periodontitis subjects (n = 80) were assessed for immunoglobulin G titers to A. actinomycetemcomitans serotypes a/b/c and to each CDT subunit (CdtA, CdtB and CdtC) by ELISA. A. actinomycetemcomitans subgingival levels and neutralization of CDT activity were also analyzed. Results: Sera from 75.0% localized and 81.8% generalized aggressive periodontitis patients reacted to A. actinomycetemcomitans. A response to serotype b was detected in localized (66.7%) and generalized aggressive periodontitis (54.5%). Reactivity to A. actinomycetemcomitans correlated with subgingival colonization (R = 0.75, p < 0.05). There was no correlation between A. actinomycetemcomitans colonization or response to serotypes and the immunoglobulin G response to CDT subunits. Titers of immunoglobulin G to CdtA and CdtB did not differ among groups; however, sera of all generalized aggressive periodontitis patients reacted to CdtC. Neutralization of CDT was not correlated with levels of antibodies to CDT subunits. Conclusion: Response to CdtA and CdtB did not correlate with the periodontal status of the subject in the context of an A. actinomycetemcomitans infection. However, a response to CdtC was found in sera of generalized but not of localized aggressive periodontitis subjects. Differences in response to CdtC between generalized and localized aggressive periodontitis subjects indicate that CDT could be expressed differently by the infecting strains. Alternatively, the antibody response to CdtC could require the colonization of multiple sites.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: Inhibitory signals mediated via molecules such as programmed death-1 (PD-1) play a critical role in downmodulating immune responses and maintaining peripheral tolerance. We investigated the involvement of cytokines and PD-1 engagement in mediating the T-cell unresponsiveness to bacterial and ubiquitous antigens in periodontal diseases. Methods: Gingival and peripheral blood samples from healthy individuals and patients with chronic periodontitis were collected and used for the subsequent assays. Leukocytes in the lesion site and blood were evaluated using flow cytometry. The production of interferon-gamma, interleukin-10, and transforming growth factor-P proteins was evaluated by enzyme-linked immunosorbent assay (ELISA), and the presence of PD-1+cells in the inflamed gingiva was confirmed by immunofluorescence confocal microscopy for CD4 and PD-1 colocalization. Results: T cells from patients with chronic periodontitis proliferated poorly in response to Aggregatibacter actinomycetem comitans (previously Actinobacillus actinomycetemcomitans) antigen. T-cell unresponsiveness was not associated with imbalanced cytokine production. However, T cells from patients with chronic periodontitis expressed significantly higher levels of PD-1 either upon isolation or after culture with antigens. Moreover, PD-1 blocking did not result in significant T-cell proliferation in cells cultured with phytohemagglutinin or bacterial antigens. The blockade of PD-1 resulted in the increased production of IFN-gamma. In addition, CD4+ and CD8+ T cells expressing PD-1 accumulated in lesions with chronic periodontitis. Conclusion: These data show that PD-1 engagement could be involved in the modulation of IFN-gamma production by T cells in patients with chronic periodontitis. J Periodontol 2009,80:1833-1844.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Duffy binding protein (DBP), a leading malaria vaccine candidate, plays a critical role ill Plasmodium vivax erythrocyte invasion. Sixty-eight of 366 (18.6%) subjects had IgG anti-DBP antibodies by enzyme-linked immunosorbent assay (ELISA) in a community-based cross-sectional survey ill the Brazilian Amazon Basin. Despite Continuous exposure to low-level malaria transmission, the overall seroprevalence decreased to 9.0% when the Population was reexamined 12 months later. Antibodies from 16 of 50 (360%) Subjects who were ELISA-positive at the baseline were able to inhibit erythrocyte binding to at least one of two DBP variants tested. Most (13 of 16) of these subjects still had inhibitory antibodies when reevaluated 12 months later. Cumulative exposure to malaria was the strongest predictor of DBP seropositivity identified by Multiple logistic regression models in this population. The poor antibody recognition of DBP elicited by natural exposure to P. vivax in Amazonian populations represents a challenge to be addressed by vaccine development strategies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The dog is considered to be the natural host of Rhipicephalus sanguineus and is unable to develop appreciable resistance even after repeated feedings. The guinea pig develops strong resistance after one infestation with adult ticks. Antibody (IgG) titres against tick salivary gland antigens (SGAs) and blood leukocyte numbers in dogs and guinea pigs undergoing experimental R. sanguineus tick infestations were measured to detect a possible correlation with susceptibility or resistance of hosts. Since infested dogs develop an immediate hypersensitivity reaction to R. sanguineus antigens, total and anti-R. sanguineus SGA IgE levels were also measured in this host species. IgG and IgE antibody levels were determined by an enzyme-linked immunosorbent assay (ELISA) along three consecutive infestations of both hosts. Most dogs and guinea pigs displayed low IgG levels against R. sanguineus SGAs, though marked differences in individual response were observed. Although dog's total serum IgE levels increased significantly after infestations, no change in the amount of anti-salivary gland IgE was detected. Total and differential blood cell counts were determined in dogs and guinea pigs during primary and secondary infestation. In dogs, a tertiary infestation and a subsequent higher infestation level were also evaluated. Infested dogs did not display any alteration in blood leukocyte counts throughout the experiment. Guinea pigs, on the other hand, developed a significant basophilia during primary infestation which increased further during secondary infestation. These data reveal similarities and differences in the reactions of resistant and non-resistant hosts to ticks. They contribute for the understanding of such host-parasite relationships and will hopefully aid in the development of immune control of ticks. (C) 2003 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A vaccine containing crude Toxoplasma gondii rhoptry proteins incorporated in the immunostimulating complexes (ISCOM) adjuvant was tested in pigs for protecting against tissue cyst formation. For this, 38 mixed breed pigs were divided into four groups, G1 (vaccinated challenged, n = 10) received two doses (100 mu g/dose) of the rhoptry vaccine at days 0 and 21, G2 (vaccinated challenged, n = 10) received viable tachyzoites (7 x 10(7)) of the RH strain at day 0, G3 (unvaccinated challenged, n = 10) and G4 (unvaccinated unchallenged, n = 8). Pigs were challenged with 4 x 10(4) VEG strain oocysts 57 days later. The G1 pigs produced high IgG antibody levels in the indirect enzyme-linked immunosorbent assay (ELISA) after the second dose of rhoptry vaccine, but were not clinically protected against a high dose oocyst challenge. Partial protection was observed in G1 at the chronic phase of infection, when compared with G3. Pigs in group 2 developed high antibody levels and were protected against clinic signs. T gondii was not detected in two (G1) and three (G2) pigs by mouse bioassay. The results indicate partial protection in pigs vaccinated with a rhoptry vaccine. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A Erliquiose é uma doença zoonótica causada por bactérias gram-negativas e intracelulares obrigatórias. A Anaplasmose Granulocítica Equina - AGE (anteriormente denominada Erliquiose Granulocítica Equina, EGE) é uma enfermidade sazonal, normalmente auto-limitante em equinos. No Brasil, existem poucos relatos deste agente erliquial, bem como de seus vetores naturais. Atualmente, veterinários têm levantado a suspeita de casos de AGE em equinos com sinais clínicos sugestivos de erliquiose e não responsivos ao tratamento para a piroplasmose equina. O objetivo do presente estudo foi identificar equinos expostos a A. phagocytophilum por meio de técnicas sorológicas e moleculares. Vinte amostras de sangue e soro de equinos da região Centro-oeste do Brasil foram avaliados por meio do exame microscópico de capa leucocitária, ensaio imunoenzimático indireto (ELISA), reação de imunofluorescência indireta (RIFI) e reação em cadeia da polimerase (nested PCR). Adicionalmente, o diagnóstico sorológico de Theileria equi pela RIFI e ELISA foram realizados, assim como o diagnóstico molecular pelo nPCR. Treze (65%) amostras de soro foram positivas para A. phagocytophilum pelo teste de ELISA, entretanto nenhum equino foi positivo pelo exame microscópico da capa leucocitária ou nPCR. Anticorpos IgG anti-T. equi foram detectados em 18 (90%) e 17 (85%) equinos pela RIFI e ELISA, respectivamente e o agente foi detectado em 9 (45%) animais pelo nPCR. Estes dados sugerem importante informação para o entendimento da ocorrência da AGE e piroplasmose equina no Centro-oeste do Brasil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This research investigated the pattern of antibody response by means of enzyme linked immunosorbent assay (Elisa) and indirect fluorescent antibody test (IFAT) through the course of experimental Trypanosoma evansi infection in dogs. Clinical and parasitological features were also studied. The average prepatent period was 11.2 days and parasitaemia showed an undulating course. Biometrical study of parasites revealed a mean total length of 21.68mm. The disease was characterized by intermittent fever closely related to the degree of parasitaemia and main clinical signs consisted of pallor of mucous membrane, edema, progressive emaciation and enlargement of palpable lymph nodes. Diagnostic antibody was detected within 12 to 15 days and 15 to 19 days of infection by IFAT and Elisa, respectively. High and persistent antibody levels were detected by both tests and appeared not to correlate with control of parasitaemia

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)