Chemical structural effects on γ-ray spectra of positron annihilation in fluorobenzenes

Spectra of ?-ray Doppler shifts for positron annihilation in benzene and its fluoro-derivatives are simulated using low energy plane wave positron (LEPWP) approximation. The results are compared with available measurements. It is found that the Doppler shifts in these larger aromatic compounds are dominated by the contributions of the valence electrons and that the LEPWP model overestimates the measurements by approximately 30%, in agreement with previous findings in noble gases and small molecules. It is further revealed that the halogen atoms not only switch the sign of the charges on carbon atoms that they bond to, but that they also polarize other C-H bonds in the molecule leading to a redistribution of the molecular electrostatic potentials. As a result, it is likely that the halogen atoms contribute more significantly to the annihilation process. The present study also suggests that, while the Doppler shifts are sensitive to the number of valence electrons in the molecules, they are less sensitive to the chemical structures of isomers that have the same numbers and type of atoms and, hence, the same numbers of electrons. Further investigation of this effect is warranted. © EDP Sciences, Società Italiana di Fisica, Springer-Verlag 2012.

Evidence for relativistic features in the X-ray spectrum of Mrk 335

We present an analysis of hard X-ray features in the spectrum of the bright Sy 1 galaxy Mrk 335 observed by the XMM-Newton satellite. Our analysis confirms the presence of a broad, ionized Fe Ka emission line in the spectrum, first found by Gondoin et al. The broad line can be modelled successfully by relativistic accretion disc reflection models. This interpretation is unusually robust in the case of Mrk 335 because of the lack of any ionized ('warm') absorber and the absence a clear narrow core to the line. Partial covering by neutral gas cannot, however, be ruled out statistically as the origin of the broad residuals. Regardless of the underlying continuum we report, for the first time in this source, the detection of a narrow absorption feature at the rest frame energy of ~5.9 keV. If the feature is identified with a resonance absorption line of iron in a highly ionized medium, the redshift of the line corresponds to an inflow velocity of ~0.11-0.15c. We present a simple model for the inflow, accounting approximately for relativistic and radiation pressure effects, and use Monte Carlo methods to compute synthetic spectra for qualitative comparison with the data. This modelling shows that the absorption feature can plausibly be reproduced by infalling gas providing that the feature is identified with Fe xxvi. We require the inflowing gas to extend over a limited range of radii at a few tens of r to match the observed feature. The mass accretion rate in the flow corresponds to 60 per cent of the Eddington limit, in remarkable agreement with the observed rate. The narrowness of the absorption line tends to argue against a purely gravitational origin for the redshift of the line, but given the current data quality we stress that such an interpretation cannot be ruled out. © 2006 The Authors.

The combined effects of diabetes and ionising radiation on the rat retina: an ultrastructural study

The combined effect of STZ-diabetes and ionising radiation on the rat retina was investigated. Wistar rats, which had been diabetic for 6 months, were irradiated with a single dose of x-rays (1500 cGy) and the ultrastructural effects evaluated at 4-10 mths post-irradiation. At 4 months post-irradiation, the outer nuclear layer of the retina was greatly reduced in thickness and the photoreceptor outer segments were disorganised and reduced in length. In addition, the nerve fibre layer contained many cytoid bodies and there were many redundant basement membrane tubes throughout the inner retina. By 6 months post-irradiation, the photoreceptor cells were virtually absent, bringing the external limiting membrane into close apposition to the RPE. Throughout large areas of the outer retina, RPE cells were hypertrophic and some had proliferated into the inner retina. In many regions, proliferating retinal capillaries were observed within the RPE layer, and at 8 months post-irradiation, some vessels extended into the inner retina accompanied by RPE cells. At 10 months post-irradiation, the RPE was atrophic and degenerative with retinal glial cells coming into contact with Bruch's membrane. In some areas, the glia which had breached Bruch's membrane had invaded the underlying choroid. Where glial cells contacted the choriocapillaries, the vessels assumed the appearance of retinal vessels with plump endothelia and no fenestrations. This study has described a progressive inner retinal ischemia, with cytoid bodies, capillary non-perfusion and general atrophy of the inner retina intensifying markedly with increasing post-irradiation time.(ABSTRACT TRUNCATED AT 250 WORDS)

The spotty donor star in the X-ray transient Cen X-4

We accurately determine the fundamental system parameters of the neutron star X-ray transient Cen X-4 solely using phase-resolved high-resolution UV-Visual Echelle Spectrograph spectroscopy. We first determine the radial-velocity curve of the secondary star and then model the shape of the phase-resolved absorption line profiles using an X-ray binary model. The model computes the exact rotationally broadened, phase-resolved spectrum and does not depend on assumptions about the rotation profile, limb-darkening coefficients and the effects of contamination from an accretion disc. We determine the secondary star-to-neutron star binary mass ratio to be 0.1755 ± 0.0025, which is an order of magnitude more accurate than previous estimates. We also constrain the inclination angle to be 32^{+8}_{-2} degrees. Combining these values with the results of the radial-velocity study gives a neutron star mass of 1.94^{+0.37}_{-0.85}M⊙ consistent with previous estimates. Finally, we perform the first Roche tomography reconstruction of the secondary star in an X-ray binary. The tomogram reveals surface inhomogeneities that are due to the presence of cool starspots. A large cool polar spot, similar to that seen in Doppler images of rapidly rotating isolated stars, is present on the Northern hemisphere of the K7 secondary star and we estimate that ~4 percent of the total surface area of the donor star is covered with spots.This evidence for starspots supports the idea that magnetic braking plays an important role in the evolution of low-mass X-ray binaries.

A search for star-planet interactions in the υ Andromedae system at X-ray and optical wavelengths

Context. Close-in, giant planets are expected to influence their host stars via tidal or magnetic interaction. But are these effects in X-rays strong enough in suitable targets known so far to be observed with today's instrumentation? Aims: The υ And system, an F8V star with a Hot Jupiter, was observed to undergo cyclic changes in chromospheric activity indicators with its innermost planet's period. We aim to investigate the stellar chromospheric and coronal activity over several months. Methods: We therefore monitored the star in X-rays as well as at optical wavelengths to test coronal and chromospheric activity indicators for planet-induced variability, making use of the Chandra X-ray Observatory as well as the echelle spectrographs FOCES and HRS at Calar Alto (Spain) and the Hobby-Eberly Telescope (Texas, US). Results: The stellar activity level is low, as seen both in X-rays as in Ca ii line fluxes; the chromospheric data show variability with the stellar rotation period. We do not find activity variations in X-rays or in the optical that can be traced back to the planet. Conclusions: Gaining observational evidence of star-planet interactions in X-rays remains challenging.

Non-equilibrium modeling of the FE XVII 3C/3D Line Ratio in an Intense X-ray Free-electron Laser Excited Plasma

Recent measurements using an X-ray Free Electron Laser (XFEL) and an Electron Beam Ion Trap at the Linac Coherent Light Source facility highlighted large discrepancies between the observed and theoretical values for the Fe XVII 3C/3D line intensity ratio. This result raised the question of whether the theoretical oscillator strengths may be significantly in error, due to insufficiencies in the atomic structure calculations. We present time-dependent spectral modeling of this experiment and show that non-equilibrium effects can dramatically reduce the predicted 3C/3D line intensity ratio, compared with that obtained by simply taking the ratio of oscillator strengths. Once these non-equilibrium effects are accounted for, the measured line intensity ratio can be used to determine a revised value for the 3C/3D oscillator strength ratio, giving a range from 3.0 to 3.5. We also provide a framework to narrow this range further, if more precise information about the pulse parameters can be determined. We discuss the implications of the new results for the use of Fe XVII spectral features as astrophysical diagnostics and investigate the importance of time-dependent effects in interpreting XFEL-excited plasmas.

Mid-Century Molecular: The Material Culture of X-ray Crystallographic Visualisation across Postwar British Science and Industrial Design

This thesis investigates the use and significance of X-ray crystallographic visualisations of molecular structures in postwar British material culture across scientific practice and industrial design. It is based on research into artefacts from three areas: X-ray crystallographers’ postwar practices of visualising molecular structures using models and diagrams; the Festival Pattern Group scheme for the 1951 Festival of Britain, in which crystallographic visualisations formed the aesthetic basis of patterns for domestic objects; and postwar furnishings with a ‘ball-and-rod’ form and construction reminiscent of those of molecular models. A key component of the project is methodological. The research brings together subjects, themes and questions traditionally covered separately by two disciplines, the history of design and history of science. This focus necessitated developing an interdisciplinary set of methods, which results in the reassessment of disciplinary borders and productive cross-disciplinary methodological applications. This thesis also identifies new territory for shared methods: it employs network models to examine cross-disciplinary interaction between practitioners in crystallography and design, and a biographical approach to designed objects that over time became mediators of historical narratives about science. Artefact-based, archival and oral interviewing methods illuminate the production, use and circulation of the objects examined in this research. This interdisciplinary approach underpins the generation of new historical narratives in this thesis. It revises existing histories of the cultural transmissions between X-ray crystallography and the production and reception of designed objects in postwar Britain. I argue that these transmissions were more complex than has been acknowledged by historians: they were contingent upon postwar scientific and design practices, material conditions in postwar Britain and the dynamics of historical memory, both scholarly and popular. This thesis comprises four chapters. Chapter one explores X-ray crystallographers’ visualisation practices, conceived here as a form of craft. Chapter two builds on this, demonstrating that the Festival Pattern Group witnesses the encounter between crystallographic practice, design practice and aesthetic ideologies operating within social networks associated with postwar modernisms. Chapters three and four focus on ball-and-rod furnishings in postwar and present-day Britain, respectively. I contend that strong relationships between these designed objects and crystallographic visualisations, for example the appellation ‘atomic design’, have been largely realised through historical narratives active today in the consumption of ‘retro’ and ‘mid-century modern’ artefacts. The attention to contemporary historical narratives necessitates this dual historical focus: the research is rooted in the period from the end of the Second World War until the early 1960s, but extends to the history of now. This thesis responds to the need for practical research on methods for studying cross-disciplinary interactions and their histories. It reveals the effects of submitting historical subjects that are situated on disciplinary boundaries to interdisciplinary interpretation. Old models, such as that of unidirectional ‘influence’, subside and the resulting picture is a refracted one: this study demonstrates that the material form and meaning of crystallographic visualisations, within scientific practice and across their use and echoes in designed objects, are multiple and contingent.

Composition analysis of high-Tc superconducting thin films by quantitative x-ray fluorescence

A method is presented for determining the composition of thin films containing the elements Bi, Sr, Br, Cu, and Ca. Quantitative x-ray fluorescence (XRF) consisting of radioactive sources (secondary foil excitor 241Am-Mo source and 55Pe source), a Si(Li) detector, and a multichannel analyzer were employed. The XRF system was calibrated by using sol gel thin films of known element composition and also by sputtered thin films analyzed by the conventional Rutherford Back Scattering (RBS). The XRF system has been used to assist and optimize the sputter target composition required to produce high-Tc BiSrCaCuO films with the desired metal composition.

X-Ray spectra of superheavy and quasi-superheavy elements

We discuss the possibility of identifying superheavy elements from the observation of their M-shell x-ray spectra, which might occur during the collision of a superheavy element with a heavy target. The same question is discussed for the possible observation of the x-rays from the quasimolecule (quasi-superheavy element) which is formed during such a heavy-ion collision. It is shown that it is very difficult, if not impossible, to determine any information about the interesting quantum electrodynamical effects from the M-shell x-ray spectra of these quasimolecules.

Analytical methodologies based on X-Ray Fluorescence Spectrometry (XRF) and Inductively Couple Plasma Spectroscopy (ICP) for the assessment of metal dispersal around mining environments

La investigació que es presenta en aquesta tesi es centra en l'aplicació i millora de metodologies analítiques existents i el desenvolupament de nous procediments que poden ser utilitzats per a l'estudi dels efectes ambientals de la dispersió dels metalls entorn a les zones mineres abandonades. En primer lloc, es van aplicar diferents procediments d'extracció simple i seqüencial per a estudiar la mobilitat, perillositat i bio-disponibilitat dels metalls continguts en residus miners de característiques diferents. Per altra banda, per a estudiar les fonts potencials de Pb en la vegetació de les zones mineres d'estudi, una metodologia basada en la utilització de les relacions isotòpiques de Pb determinades mitjançant ICP-MS va ser avaluada. Finalment, tenint en compte l'elevat nombre de mostres analitzades per a avaluar l'impacte de les activitats mineres, es va considerar apropiat el desenvolupament de mètodes analítics d'elevada productivitat. En aquest sentit la implementació d'estratègies quantitatives així com l'aplicació de les millores instrumentals en els equips de XRF han estat avaluades per a aconseguir resultats analítics fiables en l'anàlisi de plantes. A més, alguns paràmetres de qualitat com la precisió, l'exactitud i els límits de detecció han estat curosament determinats en les diverses configuracions de espectròmetres de XRF utilitzats en el decurs d'aquest treball (EDXRF, WDXRF i EDPXRF) per a establir la capacitat de la tècnica de XRF com a tècnica alternativa a les clàssiques comunament aplicades en la determinació d'elements en mostres vegetals.

Pressure-jump X-ray studies of liquid crystal transitions in lipids

In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.

Block copolymers of ethylene oxide and phenyl glycidyl ether: micellization, gelation, and drug solubilization

Three triblock copolymers of ethylene oxide and phenyl glycidyl ether, type E(m)G(n)E(m), where G = OCH2-CH(CH2OC6H5) and E = OCH2CH2, were synthesized and characterized by gel-permeation chromatography, matrix-assisted laser desorption ionization time-of-flight mass spectrometry, and NMR spectroscopy. Their association properties in aqueous solution were investigated by surface tensiometry and light scattering, yielding values of the critical micelle concentration (cmc), the hydrodynamic radius, and the association number. Gel boundaries in concentrated micellar solution were investigated by tube inversion, and for one copolymer, the temperature and frequency dependence of the dynamic moduli served to confirm and extend the phase diagram and to highlight gel properties. Small-angle X-ray scattering was used to investigate gel structure. The overall aim of the work was to define a block copolymer micellar system with better solubilization capacity for poorly soluble aromatic drugs than had been achieved so far by use of block copoly(oxyalkylene)s. Judged by the solubilization of griseofulvin in aqueous solutions of the E(m)G(n)E(m) copolymers, this aim was achieved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Preliminary results on the non-thermal effects of 200-350 GHz radiation on the growth rate of S. cerevisiae cells in microcolonies

We report preliminary results from studies of biological effects induced by non-thermal levels of non-ionizing electromagnetic radiation. Exponentially growing Saccharomyces cerevisiae yeast cells grown on dry media were exposed to electromagnetic fields in the 200–350 GHz frequency range at low power density to observe possible non-thermal effects on the microcolony growth. Exposure to the electromagnetic field was conducted over 2.5 h. The data from exposure and control experiments were grouped into either large-, medium- or small-sized microcolonies to assist in the accurate assessment of growth. The three groups showed significant differences in growth between exposed and control microcolonies. A statistically significant enhanced growth rate was observed at 341 GHz. Growth rate was assessed every 30 min via time-lapse photography. Possible interaction mechanisms are discussed, taking into account Frohlich's hypothesis.

Phase separated structures in tethered dPS–PMMA copolymer films revealed using X-ray scattering with a novel contrast enhancement agent

Tethered deuterated polystyrene-block-polymethyl methacrylate films have been examined by X-ray scattering both in their native state and following treatment with ruthenium tetroxide. The use of the stain, while increasing the thickness of the films, does not significantly alter the lateral structure or periodicity of the films and provides contrast between the two blocks. Both the periodicity of the films and the structure normal to the surface have been identified following staining. Experiments were also performed on films treated by a solvent exchange process, and the effects of staining on these films are discussed.