965 resultados para X-ray study
Resumo:
La investigació que es presenta en aquesta tesi es centra en l'aplicació i millora de metodologies analítiques existents i el desenvolupament de nous procediments que poden ser utilitzats per a l'estudi dels efectes ambientals de la dispersió dels metalls entorn a les zones mineres abandonades. En primer lloc, es van aplicar diferents procediments d'extracció simple i seqüencial per a estudiar la mobilitat, perillositat i bio-disponibilitat dels metalls continguts en residus miners de característiques diferents. Per altra banda, per a estudiar les fonts potencials de Pb en la vegetació de les zones mineres d'estudi, una metodologia basada en la utilització de les relacions isotòpiques de Pb determinades mitjançant ICP-MS va ser avaluada. Finalment, tenint en compte l'elevat nombre de mostres analitzades per a avaluar l'impacte de les activitats mineres, es va considerar apropiat el desenvolupament de mètodes analítics d'elevada productivitat. En aquest sentit la implementació d'estratègies quantitatives així com l'aplicació de les millores instrumentals en els equips de XRF han estat avaluades per a aconseguir resultats analítics fiables en l'anàlisi de plantes. A més, alguns paràmetres de qualitat com la precisió, l'exactitud i els límits de detecció han estat curosament determinats en les diverses configuracions de espectròmetres de XRF utilitzats en el decurs d'aquest treball (EDXRF, WDXRF i EDPXRF) per a establir la capacitat de la tècnica de XRF com a tècnica alternativa a les clàssiques comunament aplicades en la determinació d'elements en mostres vegetals.
Resumo:
Root characteristics of seedlings of five different barley genotypes were analysed in 2D using gel chambers, and in 3D using soil sacs that were destructively harvested and pots of soil that were assessed non-invasively using X-ray microtomography. After 5 days, Chime produced the greatest number of root axes (similar to 6) and Mehola significantly less (similar to 4) in all growing methods. Total root length was longest in GSH01915 and shortest in Mehola for all methods, but both total length and average root diameter were significantly larger for plants grown in gel chambers than those grown in soil. The ranking of particular growth traits (root number, root angular spread) of plants grown in gel plates, soil sacs and X-ray pots was similar, but plants grown in the gel chambers had a different order of ranking for root length to the soil-grown plants. Analysis of angles in soil-grown plants showed that Tadmore had the most even spread of individual roots and Chime had a propensity for non-uniform distribution and root clumping. The roots of Mehola were less well spread than the barley cultivars supporting the suggestion that wild and landrace barleys tend to have a narrower angular spread than modern cultivars. The three dimensional analysis of root systems carried out in this study provides insights into the limitations of screening methods for root traits and useful data for modelling root architecture.
Resumo:
A novel capillary flow device has been developed and applied to study the orientation of worm-like micelles, among other systems. Small-angle X-ray scattering (SAXS) data from micelles formed by a Pluronic block copolymer in aqueous salt solution provides evidence for the formation of worm-like micelles, which align under flow. A transition from a rod-like form factor to a less persistent conformation is observed under flow. Flow alignment of worm-like micelles formed by the low molar mass amphiphile system cetyl pyridinium chloride+sodium salicylate is studied for comparative purposes. Here, inhomogenous flow at the micron scale is revealed by streaks in the small-angle light scattering pattern perpendicular to the flow direction. Copyright (c) 2006 John Wiley & Sons, Ltd.
Resumo:
In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.
Resumo:
Phenylphosphinic acid (HPhPO2H) is oxidized to phenylphosphonic acid (PhPO3H2) at room temperature using a solution of [Cu2(μ-O2CCH3)4(H2O)2] in pyridine. The phenylphosphonic acid was recovered as the monomeric copper(II) complex [Cu(PhPO3H)2(C5H5N)4]·H2O (1a), and the reaction thought to proceed via a copper(I) intermediate. Recrystallization of 1a from methanol gave [Cu(PhPO3H)2(C5H5N)4]·2CH3OH (1b). The unsolvated complex [Cu(PhPO3H)2(C5H5N)4] (1c) was prepared by refluxing polymeric [Cu(PhPO3)(H2O)] (2) in pyridine. The X-ray crystal structures of 1b and 1c show that in each of these monomeric complexes the copper(II) ion is ligated by four equatorial pyridine molecules and two axial monoanionic phenylphosphonate groups. A cyclic voltammetric study of 1a revealed a quasi-reversible Cu2+/Cu+ couple with E1/2 = +228 mV (vs Ag/AgCl).
Resumo:
Mannitol is a polymorphic pharmaceutical excipient, which commonly exists in three forms: alpha, beta and delta. Each polymorph has a needle-like morphology, which can give preferred orientation effects when analysed by X-ray powder diffractometry (XRPD) thus providing difficulties for quantitative XRPD assessments. The occurrence of preferred orientation may be demonstrated by sample rotation and the consequent effects on X-ray data can be minimised by reducing the particle size. Using two particle size ranges (less than 125 and 125–500�microns), binary mixtures of beta and delta mannitol were prepared and the delta component was quantified. Samples were assayed in either a static or rotating sampling accessory. Rotation and reducing the particle size range to less than�125 microns halved the limits of detection and quantitation to 1 and 3.6%, respectively. Numerous potential sources of assay errors were investigated; sample packing and mixing errors contributed the greatest source of variation. However, the rotation of samples for both particle size ranges reduced the majority of assay errors examined. This study shows that coupling sample rotation with a particle size reduction minimises preferred orientation effects on assay accuracy, allowing discrimination of two very similar polymorphs at around the 1% level
Resumo:
Naphthalene and anthracene transition metalates are potent reagents, but their electronic structures have remained poorly explored. A study of four Cp*-substituted iron complexes (Cp* = pentamethylcyclopentadienyl) now gives rare insight into the bonding features of such species. The highly oxygen- and water-sensitive compounds [K(18-crown- 6){Cp*Fe(η4-C10H8)}] (K1), [K(18-crown-6){Cp*Fe(η4-C14H10)}] (K2), [Cp*Fe(η4-C10H8)] (1), and [Cp*Fe(η4-C14H10)] (2) were synthesized and characterized by NMR, UV−vis, and 57Fe Mössbauer spectroscopy. The paramagnetic complexes 1 and 2 were additionally characterized by electron paramagnetic resonance (EPR) spectroscopy and magnetic susceptibility measurements. The molecular structures of complexes K1, K2, and 2 were determined by single-crystal X-ray crystallography. Cyclic voltammetry of 1 and 2 and spectroelectrochemical experiments revealed the redox properties of these complexes, which are reversibly reduced to the monoanions [Cp*Fe(η4-C10H8)]− (1−) and [Cp*Fe(η4-C14H10)]− (2−) and reversibly oxidized to the cations [Cp*Fe(η6-C10H8)]+ (1+) and [Cp*Fe(η6-C14H10)]+ (2+). Reduced orbital charges and spin densities of the naphthalene complexes 1−/0/+ and the anthracene derivatives 2−/0/+ were obtained by density functional theory (DFT) methods. Analysis of these data suggests that the electronic structures of the anions 1− and 2− are best represented by low-spin FeII ions coordinated by anionic Cp* and dianionic naphthalene and anthracene ligands. The electronic structures of the neutral complexes 1 and 2 may be described by a superposition of two resonance configurations which, on the one hand, involve a low-spin FeI ion coordinated by the neutral naphthalene or anthracene ligand L, and, on the other hand, a low-spin FeII ion coordinated to a ligand radical L•−. Our study thus reveals the redox noninnocent character of the naphthalene and anthracene ligands, which effectively stabilize the iron atoms in a low formal, but significantly higher spectroscopic oxidation state.
Resumo:
Measurements of the ionospheric E region during total solar eclipses in the period 1932-1999 have been used to investigate the fraction of Extreme Ultra Violet and soft X-ray radiation, phi, that is emitted from the limb corona and chromosphere. The relative apparent sizes of the Moon and the Sun are different for each eclipse, and techniques are presented which correct the measurements and, therefore, allow direct comparisons between different eclipses. The results show that the fraction of ionising radiation emitted by the limb corona has a clear solar cycle variation and that the underlying trend shows this fraction has been increasing since 1932. Data from the SOHO spacecraft are used to study the effects of short-term variability and it is shown that the observed long-term rise in phi has a negligible probability of being a chance occurrence.
Resumo:
Micro-computed tomography (μCT) has been successfully used to study the cardiovascular system of mouse embryos in situ. With the use of barium as a suitable contrast agent, blood vessels have been imaged and analysed quantitatively such as blood volume and vessel sizes on embryos of ages 14.5 to 16.5 days old. The advantage of using this imaging modality is that it has provided three dimensional information whilst leaving samples intact for further study.
Resumo:
Near ambient-pressure X-ray photoelectron spectroscopy (NAP-XPS) is used to study the chemical state of methane oxidation catalysts in-situ. Al2O3{supported Pd catalysts are prepared with different particle sizes ranging from 4 nm to 10 nm. These catalysts were exposed to conditions similar to those used in the partial oxidation of methane (POM) to syn-gas and simultaneously monitored by NAP-XPS and mass spectrometry. NAP-XPS data show changes in the oxidation state of the palladium as the temperature in- creases, from metallic Pd0 to PdO, and back to Pd0. Mass spectrometry shows an increase in CO production whilst the Pd is in the oxide phase, and the metal is reduced back under presence of newly formed H2. A particle size effect is observed, such that CH4 conversion starts at lower temperatures with larger sized particles from 6 nm to 10 nm. We find that all nanoparticles begin CH4 conversion at lower temperatures than polycrystalline Pd foil.
Resumo:
Impurity-interstitial dipoles in calcium fluoride solutions with Al3+, Yb3+ and La3+ fluorides were studied using the thermally stimulated depolarization current (TSDC) technique. The dipolar complexes are formed by substitutional trivalent ions in Ca2+ sites and interstitial fluorine in nearest neighbor sites. The relaxations observed at 150 K are assigned to dipoles nnR(S)(3+)- F-i(-) (R-S = La or Yb). The purpose of this work is to study the processes of energy storage in the fluorides following X-ray and gamma irradiation. Computer modelling techniques are used to obtain the formation energy of dipole defects. (C) 2007 Elsevier Ltd. All rights reserved.
Resumo:
This study presents a comparison of the X-ray transmission through microsized and nanosized materials. For this purpose CuO nanoparticles, with 13.4 nm average grain size, and CuO microparticles, with a mean particle size of 56 mu m, were incorporated separately to beeswax in a concentration of 5%. Results show that the transmission through the above material plates with microsized and nanosized CuO was almost the same for X-ray beams generated at 60 and 102 kV tube voltages. However, for the radiation beams generated at 26 and 30 kV tube voltages the X-rays are more attenuated by the nanostructured CuO plates by a factor of at least 14%. Results suggest that the difference in the low energy range may be due to the higher number of particles/gram in the plates designed with CuO nanoparticles and due to the grain size effect on the X-ray transmission. (C) 2010 Elsevier Ltd. All rights reserved.
Resumo:
Glutathione S-transferases (GSTs) form a group of multifunctional isoenzymes that catalyze the glutathione-dependent conjugation and reduction reactions involved in the cellular detoxification of xenobiotic and endobiotic compounds. GST from Xylella fastidiosa (xfGST) was overexpressed in Escherichia coli and purified by conventional affinity chromatography. In this study, the crystallization and preliminary X-ray analysis of xfGST is described. The purified protein was crystallized by the vapour-diffusion method, producing crystals that belonged to the triclinic space group P1. The unit-cell parameters were a = 47.73, b = 87.73, c = 90.74 angstrom, alpha = 63.45, beta = 80.66, gamma = 94.55 degrees. xfGST crystals diffracted to 2.23 angstrom resolution on a rotating-anode X-ray source.