X-ray Polarization Spectroscopy from Ultra-Intense Interactions

Detailed knowledge of fast electron energy transport following the interaction of ultrashort intense laser pulses is a key subject for fast ignition. This is a problem relevant to many areas of laser-plasma physics with particular importance to fast ignition and X-ray secondary source development, necessary for the development of large-scale facilities such as HiPER and ELI. Operating two orthogonal crystal spectrometers set at Bragg angles close to 45 degrees determines the X-ray s- and p-polarization ratio. From this ratio, it is possible to infer the velocity distribution function of the fast electron beam within the dense plasma. We report on results of polarization measurements at high density for sulphur and nickel buried layer targets in the high intensity range of 10(19) - 10(21) Wcm(-2). We observe at 45 degrees the Ly-alpha doublet using two sets of orthogonal highly-orientated pyrolytic graphite (HOPG) crystals set in 1(st) order for sulphur and 3(rd) order for nickel.

The complex ion structure of warm dense carbon measured by spectrally resolved x-ray scattering

We present measurements of the complex ion structure of warm dense carbon close to the melting line at pressures around 100 GPa. High-pressure samples were created by laser-driven shock compression of graphite and probed by intense laser-generated x-ray sources with photon energies of 4.75 keV and 4.95 keV. High-efficiency crystal spectrometers allow for spectrally resolving the scattered radiation. Comparing the ratio of elastically and inelastically scattered radiation, we find evidence for a complex bonded liquid that is predicted by ab-initio quantum simulations showing the influence of chemical bonds under these conditions. Using graphite samples of different initial densities we demonstrate the capability of spectrally resolved x-ray scattering to monitor the carbon solid-liquid transition at relatively constant pressure of 150 GPa. Showing first single-pulse scattering spectra from cold graphite of unprecedented quality recorded at the Linac Coherent Light Source, we demonstrate the outstanding possibilities for future high-precision measurements at 4th Generation Light Sources.

X-ray diffraction, thermal analysis, and Raman scattering study of K2BeF4 and comparation to other member of the (beta)-K2SO4 family with ferroelectric -paraelectric transition

Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.

X-Ray Crysatllographic and Vibrational Spectroscopic Studies of Thorium Bromate Hydrate

Th(BrO3)3·H2O single crystals were grown from its aqueous solution at room temperature. Single crystal XRD, Raman and FTIR techniques were used to investigate the crystal structure. The crystal structure was solved by Patterson method. The as grown crystals are in monoclinic system with space group P21/c. The unit cell parameters are a = 12.8555(18) Å, b = 7.8970(11) Å, c = 9.0716(10) Å,  = 90°,  = 131.568° and  = 90° and unit cell volume is 689.1(2) Å3. Z = 8, R factor is 5.9. The Raman and FTIR studies indicate the lowering of symmetry of bromate anion from C3V to C1. Hydrogen bonds with varying strengths are present in the crystal. The centrosymmetric space group P21/c of the crystal is confirmed by the non-coincidence of majority of Raman and IR bands

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

A novel cation induced polymeric chain in Na-8[{Cu(gly)(2)}(2)]{H-2(H2W12O42)}] center dot 24H(2)O: hydrothermal synthesis, spectroscopic characterization and X-ray structure analysis

A novel bis(glycinato) copper(II) paradodecatungstate Na-8[{Cu(gly)(2)}(2)]-{H-2(H2W12O42)}] center dot 24H(2)O (1) has been synthesized under hydrothermal conditions. The crystal structure of 1 reveals an infinite one-dimensional chain along the [100] direction and is built from paradodecatungstate (H2W12O42)(10-) clusters joined through [Cu(gly)(2)] moieties. Parallel chains are interlinked by NaO6 octahedra to generate a two-dimensional network.

Thallium pi-cation complexation by calix[4]tubes: Tl-205 NMR and X-ray evidence

Thallium cation complexation by calix[4]tubes has been investigated by a combination of (TI)-T-205, H-1 NMR and ES MS demonstrating the solution formation of a dithallium complex in which the cations are held in the calix[4]arene cavities. In addition, the structure of the complex has been determined in the solid state revealing the cations to be held exclusively by pi-cation interactions. Furthermore, this crystal structure has been used as the basis for molecular dynamics simulations to confirm that binding of the smaller K+ cation in the calix[4]tube cryptand like array occurs via the axial route featuring a g-cation intermediate.

Tuning of redox potential and visible absorption band of ruthenium(II) complexes of (benzimidazolyl) derivatives: synthesis, characterization, spectroscopic and redox properties, X-ray structures and DFT calculations

Six ruthenium(II) complexes have been prepared using the tridentate ligands 2,6-bis(benzimidazolyl) pyridine and bis(2-benzimidazolyl methyl) amine and having 2,2'-bipyridine, 2,2':6',2 ''-terpyridine, PPh3, MeCN and chloride as coligands. The crystal structures of three of the complexes trans-[Ru(bbpH(2))(PPh3)(2)(CH3CN)I(ClO4)(2) center dot 2H(2)O (2), [Ru(bbpH(2))(bpy)Cl]ClO4 (3) and [Ru(bbpH(2))(terpy)](ClO4)(2) (4) are also reported. The complexes show visible region absorption at 402-517 nm, indicating that it is possible to tune the visible region absorption by varying the ancillary ligand. Luminescence behavior of the complexes has been studied both at RT and at liquid nitrogen temperature (LNT). Luminescence of the complexes is found to be insensitive to the presence of dioxygen. Two of the complexes [Ru(bbpH(2))(bpy)Cl]ClO4 (3) and [Ru(bbpH(2))(terpy]ClO4)(2) (4) show RT emission in the NIR region, having lifetime, quantum yield and radiative constant values suitable for their application as NIR emitter in the solid state devices. The DFT calculations on these two complexes indicate that the metal t(2g) electrons are appreciably delocalized over the ligand backbone. (C) 2006 Elsevier B.V. All rights reserved.

Solvent influences on metastable polymorph lifetimes: real-time interconversions using energy dispersive X-ray diffractometry

Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Nickel(II) and copper(II) complexes of Schiff base ligands containing N4O2 and N4S2 donors with pyrrole terminal binding groups: synthesis, characterization, X-ray structures, DFT and electrochemical studies

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Metal complexes with atropisomeric sulfur ligands in asymmetric hydroformylation X-ray structure of [Rh2(μ-biphes)(cod)2] (H2biphes = 4,4′-biphenanthrene-3,3′-dithiol)

The addition of the atropisomeric racemic sulfur compound 4,4′-biphenanthrene-3,3′-dithiol (H2 biphes) to a dichloromethane solution of [{M(μ-OMe)(cod)}2] (M = Rh, Ir, cod = cycloocta-1,5-diene) afforded the dithiolate-bridged complexes [{Rh2(μ-biphes)(cod)2}n] (n = 2 5 or n = 1 6) and [{Ir2(μ-biphes)(cod)2}n]·nCH2Cl27. When 1,1′-binaphthalene-2,2′-dithiol (H2 binas) reacted with [{Ir(μ-OMe)(cod)}2], complex [Ir2(μ-binas)(cod)2] 8 was obtained. Complexes 5 and 6 reacted with carbon monoxide to give the dinuclear tetracarbonyl complex [Rh2(μ-biphes)(CO)4] 9. The reaction of 9 with PR3 provided the mixed-ligand complexes [{Rh2(μ-biphes)(CO)2(PR3)2}2] · xCH2Cl2 (R = Ph, x = 2 10, C6H11, x = 1 11) and [{Rh2(μ-biphes)(CO)3(PR3)}2] · CH2Cl212 (R = OC6H4But-o). The crystal structure of 6 was determined by X-ray diffraction. Reaction of the dithioether ligand Me2biphes with [Rh(cod)2]ClO4 in CH2Cl2 solution afforded the cationic complex [Rh(cod)(Me2biphes)]ClO4 · CH2Cl213. Asymmetric hydroformylation of styrene was performed using the complexes described. The extent of aldehyde conversion ranges from 53 to 100%, with selectivities towards branched aldehydes in the range 51 to 96%. The enantioselectivities were quite low and did not exceed 20%.

Penciclovir solubility in Eudragit films: a comparison of X-ray, thermal, microscopic and release rate techniques

The solubility of penciclovir (C10N5O3H17) in a novel film formulation designed for the treatment of cold sores was determined using X-ray, thermal, microscopic and release rate techniques. Solubilities of 0.15–0.23, 0.44, 0.53 and 0.42% (w/w) resulted for each procedure. Linear calibration lines were achieved for experimentally and theoretically determined differential scanning calorimetry (DSC) and X-ray powder diffractometry (XRPD) data. Intra- and inter-batch data precision values were determined; intra values were more precise. Microscopy was additionally useful for examining crystal shape, size distribution and homogeneity of drug distribution within the film. Whereas DSC also determined melting point, XRPD identified polymorphs and release data provided relevant kinetics.

Unraveling the electronic structures of low-valent naphthalene and anthracene iron complexes: x-ray, spectroscopic, and density functional theory studies

Naphthalene and anthracene transition metalates are potent reagents, but their electronic structures have remained poorly explored. A study of four Cp*-substituted iron complexes (Cp* = pentamethylcyclopentadienyl) now gives rare insight into the bonding features of such species. The highly oxygen- and water-sensitive compounds [K(18-crown- 6){Cp*Fe(η4-C10H8)}] (K1), [K(18-crown-6){Cp*Fe(η4-C14H10)}] (K2), [Cp*Fe(η4-C10H8)] (1), and [Cp*Fe(η4-C14H10)] (2) were synthesized and characterized by NMR, UV−vis, and 57Fe Mössbauer spectroscopy. The paramagnetic complexes 1 and 2 were additionally characterized by electron paramagnetic resonance (EPR) spectroscopy and magnetic susceptibility measurements. The molecular structures of complexes K1, K2, and 2 were determined by single-crystal X-ray crystallography. Cyclic voltammetry of 1 and 2 and spectroelectrochemical experiments revealed the redox properties of these complexes, which are reversibly reduced to the monoanions [Cp*Fe(η4-C10H8)]− (1−) and [Cp*Fe(η4-C14H10)]− (2−) and reversibly oxidized to the cations [Cp*Fe(η6-C10H8)]+ (1+) and [Cp*Fe(η6-C14H10)]+ (2+). Reduced orbital charges and spin densities of the naphthalene complexes 1−/0/+ and the anthracene derivatives 2−/0/+ were obtained by density functional theory (DFT) methods. Analysis of these data suggests that the electronic structures of the anions 1− and 2− are best represented by low-spin FeII ions coordinated by anionic Cp* and dianionic naphthalene and anthracene ligands. The electronic structures of the neutral complexes 1 and 2 may be described by a superposition of two resonance configurations which, on the one hand, involve a low-spin FeI ion coordinated by the neutral naphthalene or anthracene ligand L, and, on the other hand, a low-spin FeII ion coordinated to a ligand radical L•−. Our study thus reveals the redox noninnocent character of the naphthalene and anthracene ligands, which effectively stabilize the iron atoms in a low formal, but significantly higher spectroscopic oxidation state.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.