Poor ovarian response in patients younger than 35 years: Is it also a qualitative decline in ovarian function?

Objective. To investigate whether poor response to controlled ovarian stimulation (COS) is due to a qualitative decline in ovarian function. Methods. This retrospective cohort study included 436 patients younger than 35-years old, undergoing COS for intracytoplasmic sperm injection (ICSI). Patients with four or fewer MII oocytes after COS (poor-responder group, PR, n = 52) were age-matched with normoresponder patients (NR, n = 364). Results. Although similar duration of stimulation (10.5 +/- 0.4 and 9.3 +/- 0.8 days; p = 0.1358), increased doses of gonadotrophins (2510 +/- 865 and 2253 +/- 572 IU; p = 0.0061) were used in the PR. The results show a increased chance of cycle ending of PR (PR: 26.9% and NR: 3.1%; p < 0.0001). Although the lower total number of oocytes retrieved (2.4 +/- 1.4 and 16.2 +/- 9.3; p < 0.0001), equal rate of fertilization (70.2% and 72.0%, p = 0.1190) and high quality embryos were obtained (50.0% and 45.2%; p = 0.4895), resulting in similar implantation (14.5% and 19.7%; p = 0.2246) and abortion (10.0% and 15.4%; p = 1.00) rates, respectively. A trend towards increased pregnancy rate per embryo transfer in NR group was noted (PR: 26.3% and NR: 42.2%; p = 0.0818). Conclusions. Low ovarian response could be associated mainly with a quantitative rather than a qualitative decline in ovarian function. Therefore, even if the ovarian response to stimulation is low, patients aged <= 35 years should process to oocyte retrieval.

Light memory function in a double pin SiC device

A double pi'npin heterostructure based on amorphous SiC has a non linear spectral gain which is a function of the signal wavelength that impinges on its front or back surface. An impulse of a configurable length and amplitude is applied to a 390 nm LED which illuminates one of the sensor surfaces, followed by a time period without any illumination after which an input signal with a different wavelength is impinged upon the front surface. Results show that the intensity and duration of the impulse illumination of the surfaces influences the sensor's response with different output for the same input signal. This paper studies this effect and proposes an application as a short term light memory. (C) 2015 Elsevier B.V. All rights reserved.

Early antibiotic administration affects the gut barrier function and the immune response to oral antigen in suckling rats

Abstract: The increasingly high hygienic standards characterizing westernized societies correlate with an increasingly high prevalence of allergic disease. Initially based on these observations, the hygiene hypothesis postulates that reduced microbial stimulation during infancy impairs the immune system development and increases the risk of allergy. Moreover, there is increasing evidence that the crosstalk existing between the intestine and the resident microbiota is crucial for gut homeostasis. In particular, bacterial colonization of the gut affects the integrity of the gut barrier and stimulates the development of the gut associated immune tissue, both phenomena being essential for the immune system to mount a controlled response to food antigens. Therefore, alterations in the microbial colonization process, by compromising the barrier homeostasis, may increase the risk of food allergy. In this context, antibiotic treatment, frequently prescribed during infancy, affects gut colonization by bacteria. However, little is known about the impact of alterations in the colonization process on the maturation of the gut barrier and on the immunological response to oral antigens. The objective of this work was to determine the impact of a commercial antibiotic preparation employed in pediatric settings on the gut barrier status at the critical period of the suckling/weaning transition and to evaluate the physiological consequences of this treatment in terms of immune response to food antigens. We established an antibiotic-treated suckling rat model relevant to the pediatric population in terms of type, dose and route of administration of the antibiotic and of changes in the patterns of microbial colonization. Oral tolerance to a novel luminal antigen (ovalbumin) was impaired when the antigen was introduced during antibiotic treatment. These results paralleled to alterations in the intestinal permeability to macromolecules and reduced intestinal expression of genes coding for the major histocomptatibility complex II molecules, which suggest a reduced capacity of antigen handling and presentation in the intestine of the antibiotic-treated animals. In addition, low luminal IgA levels and reduced intestinal expression of genes coding for antimicrobial proteins suggest that protection against pathogens was reduced under antibiotic treatment. In conclusion, we observed in suckling rats that treatment with abroad-spectrum antibiotic commonly used in pediatric practices reduced the capacity of the immune system to develop tolerance. The impact of the antibiotic treatment on the immune response to the antigen-was likely mediated by the alterations of the gut microbiota, through impairment in the mechanisms of antigen handling and presentation. This work reinforces the body of data supporting a key role of the intestinal microbiota modulating the risk of allergy development and leads us to propose that the introduction of new food antigens should be avoided during antibiotic treatment in infants. Résumé: L'augmentation du niveau d'hygiène caractérisant les sociétés occidentales semble être fortement corrélée avec l'augmentation des cas d'allergie dans ces pays. De cette observation est née l'hypothèse qu'une diminution des stimuli microbiens pendant l'enfance modifie le développement du système immunitaire augmentant ainsi le risque d'allergie. En ce sens, un nombre croissant de données indiquent que les interactions existant entre l'intestin et les bactéries résidantes sont cruciales pour l'équilibre du système. En effet, la présence de bactéries dans l'intestin affecte l'intégrité de sa fonction de barrière et stimule le développement du système immunitaire intestinal. Ces deux paramètres étant essentiels à la mise en place d'une réponse contrôlée vis à vis d'un antigène reçu oralement, toute modification du processus naturel de colonisation compromettant l'équilibre intestinal pourrait augmenter le risque d'allergie. Les traitements aux antibiotiques, fréquemment prescrits en pédiatrie, modifient de façon conséquente le processus de colonisation bactérienne. Cependant peu de données existent concernant l'impact d'une altération du processus de colonisation sur la maturation de la barrière intestinale et de la réponse immunitaire dirigée contre un antigène. L'objectif de ce travail était de déterminer l'impact d'un antibiotique commercial et employé en pédiatrie sur l'état de la barrière intestinale au moment critique du sevrage et d'évaluer les conséquences physiologiques d'un tel traitement sur la réponse immune à un antigène alimentaire. Nous avons mis en place un modèle de rats allaités, traités à l'antibiotique, le plus proche possible des pratiques pédiatriques, en terme de nature, dose et voie d'administration de l'antibiotique. Nous avons constaté que l'établissement de la tolérance orale à un nouvel antigène (l'ovalbumine) est altéré quand celui-ci est donné pour la première fois au cours du traitement antibiotique. Ces résultats coïncident avec une diminution de la perméabilité intestinale aux macromolécules, ainsi qu'avec une diminution de l'expression des gènes codant pour les molécules du complexe majeur d'histocomptatibilité de classe II, suggérant une modification de l'apprêtement et de la présentation de l'antigène au niveau intestinal chez les rats traités à l'antibiotique. De plus, un faible taux d'IgA et une diminution de l'expression des gènes codant pour des protéines antimicrobiennes, observés après l'administration d'antibiotique, laissent à penser que la protection contre un pathogène est diminuée lors d'un traitement antibiotique. En conclusion, nous avons observé qu'un traitement antibiotique à large spectre d'activité, couramment utilisé en pédiatrie, réduit la capacité d'induction de la tolérance orale chez le rat allaité. L'impact du traitement antibiotique sur la réponse immune semble induite par l'altération de la flore intestinale via son effet sur les mécanismes d'apprêtement et de présentation de l'antigène. Ce travail renforce l'ensemble des données existantes qui accorde à la flore intestinale un rôle clef dans la modulation du risque de développement d'allergie et nous amène à recommander d'éviter l'introduction d'un nouvel aliment lorsqu'un enfant est traité aux antibiotiques.

Time-Course In Vivo Trafficking Pattern and Effector Function of Donor-Specific Regulatory T Cells in Response to an Allograft.

Background: Experimental data have suggested that adoptive transfer of CD4+CD25+Foxp3+ regulatory T cells (Tregs), capable of controlling immune responses to specifi c auto- or alloantigens, could be used as a therapeutic strategy to promote specifi c tolerance in T-cell mediated diseases and in organ transplantation (Tx). However, before advocating the application of immunotherapy with Tregs in Tx, we need to improve our understanding of their in vivo homeostasis, traffi cking pattern and effector function in response to alloantigens. Methods : Donor-antigen specifi c murine Tregs were generated and characterized in vitro following our described protocols. Using an adoptive transfer and skin allotransplantation model, we have analyzed the in vivo expansion and homing of fl uorescent-labeled effector T cells (Teff) and Tregs, at different time-points after Tx, using fl ow-cytometry as well as fl uorescence microscopy techniques. Results: Tregs expressed CD62L, CCR7 and CD103 allowing their homing into lymphoid and non-lymphoid tissues (gut, skin) after intravenous injection. While hyporesponsive to TCR stimulation in vitro, transferred Tregs survived, migrated to secondary lymphoid organs and preferentially expanded within the allograft draining lymph nodes. Furthermore, Foxp3+ cells could be detected inside the allograft as early as day 3-5 after Tx. At a much later time-point (day 60 after Tx), graft-infi ltrating Foxp3+ cells were also detectable in tolerant recipients. When transferred alone, CD4+CD25- Teff cells expanded within secondary lymphoid organs and infi ltrated the allograft by day 3-5 after Tx. The co-transfer of Tregs limited the expansion of alloreactive Teff cells as well as their recruitment into the allograft. The promotion of graft survival observed in the presence of Tregs was in part mediated by the inhibition of the production of effector cytokines by CD4+CD25- T cells. Conclusion: Taken together, our results suggest that the suppression of allograft rejection and the induction of Tx tolerance are in part dependant on the alloantigendriven homing and expansion of Tregs. Thus, the appropriate localization of Tregs may be critical for their suppressive function in vivo.

Decreased memory T-cell response and function in human immunodeficiency virus-infected patients with tegumentary leishmaniasis

The effects of human immunodeficiency virus (HIV) on the immune response in patients with cutaneous leishmaniasis have not yet been fully delineated. This study quantified and evaluated the function of memory T-cell subsets in response to soluble Leishmania antigens (SLA) from patients coinfected with HIV and Leishmania with tegumentary leishmaniasis (TL). Eight TL/HIV coinfected subjects and 10 HIV seronegative subjects with TL were evaluated. The proliferative response of CD4+and CD8+T-cells and naïve, central memory (CM) and effector memory (EM) CD4+T-cells in response to SLA were quantified using flow cytometry. The median cell division indices for CD4+and CD8+T-cells of coinfected patients in response to SLA were significantly lower than those in patients with Leishmania monoinfection (p < 0.05). The proportions of CM and EM CD4+T-cells in response to SLA were similar between the coinfected patients and patients with Leishmania monoinfection. However, the median CM and EM CD4+T-cell counts from coinfected patients were significantly lower (p < 0.05). The reduction in the lymphoproliferative response to Leishmaniaantigens coincides with the decrease in the absolute numbers of both EM and CM CD4+T-cells in response to Leishmania antigens in patients coinfected with HIV/Leishmania.

An immunomodulatory function for neutrophils during the induction of a CD4+ Th2 response in BALB/c mice infected with Leishmania major.

The possible immunomodulatory role of polymorphonuclear leukocytes (PMN) in CD4+ T lymphocyte differentiation in mice was examined by studying the effect of transient depletion of PMN during the early phase after Leishmania major delivery. A single injection of the PMN-depleting NIMP-R14 mAb 6 h before infection with L. major prevented the early burst of IL-4 mRNA transcription otherwise occurring in the draining lymph node of susceptible BALB/c mice. Since this early burst of IL-4 mRNA transcripts had previously been shown to instruct Th2 differentiation in mice from this strain, we examined the effect of PMN depletion on Th subset differentiation at later time points after infection. The transient depletion of PMN in BALB/c mice was sufficient to inhibit Th2 cell development otherwise occurring after L. major infection. Decreased Th2 responses were paralleled with partial resolution of the footpad lesions induced by L. major. Furthermore, draining lymph node-derived CD4+ T cells from PMN-depleted mice remained responsive to IL-12 after L. major infection, unlike those of infected BALB/c mice receiving control Ab. PMN depletion had no effect when the NIMP-R14 mAb was injected 24 h postinfection. The protective effect of PMN depletion was shown to be IL-12 dependent, as concomitant neutralization of IL-12 reversed the protective effect of PMN depletion. These results suggest a role for an early wave of PMN in the development of the Th2 response characteristic of mice susceptible to infection with L. major.

Response of the Thermal Conductivity as a Function of Water Content of a Burnt Mediterranean Loam Soil

The purpose of this research is to explore the variability on the soil thermal conductivity -λ- after a prescribe fire, and to assess the effects of the ashes on the heat transfer once it"s were incorporated into the soil matrix. Sampling plot was located in the Montgrí Massif (NE of Spain). A set of 42 soil samples between surface and 5 cm depth was collected before and after the fire. To characterize the soil chemical and physical variables were analyzed. To determine the vari-ability on the soil λ a dry-out curve per scenario (before and after fire) was determined. SoilRho® method based on ASTM D-5334-08 which was validated by LabFerrer was used. Soil thermal conductivity has shown changes in their values. Indeed, in all moisture scenarios the values of soil λ decreased after soil was burnt. The critical point in the rela-tionship ϴ (λ) for the soil after fire which always was stronger than soil before to be burnt. Soil with"white" ashes showed a high thermal conductivity. An X-Ray diffractometry analysis allowed to clarify and to verify these results. To sum up, we could say that thermal conductivity presents changes when the scenario changes, i.e. before and after to be burnt. On the other hand, the volume of ashes incorporated on the soil increased the differences between no burnt and burnt soil, showing even some improvements on the heat transfer when water content started to govern the process.

Abnormal response of left ventricular systolic function to submaximal exercise in post-partial left ventriculotomy patients

Patients with heart failure who have undergone partial left ventriculotomy improve resting left ventricular systolic function, but have limited functional capacity. We studied systolic and diastolic left ventricular function at rest and during submaximal exercise in patients with previous partial left ventriculotomy and in patients with heart failure who had not been operated, matched for maximal and submaximal exercise capacity. Nine patients with heart failure previously submitted to partial left ventriculotomy were compared with 9 patients with heart failure who had not been operated. All patients performed a cardiopulmonary exercise test with measurement of peak oxygen uptake and anaerobic threshold. Radionuclide left ventriculography was performed to analyze ejection fraction and peak filling rate at rest and during exercise at the intensity corresponding to the anaerobic threshold. Groups presented similar exercise capacity evaluated by peak oxygen uptake and at anaerobic threshold. Maximal heart rate was lower in the partial ventriculotomy group compared to the heart failure group (119 ± 20 vs 149 ± 21 bpm; P < 0.05). Ejection fraction at rest was higher in the partial ventriculotomy group as compared to the heart failure group (41 ± 12 vs 32 ± 9%; P < 0.0125); however, ejection fraction increased from rest to anaerobic threshold only in the heart failure group (partial ventriculotomy = 44 ± 17%; P = non-significant vs rest; heart failure = 39 ± 11%; P < 0.0125 vs rest; P < 0.0125 vs change in the partial ventriculotomy group). Peak filling rate was similar at rest and increased similarly in both groups at the anaerobic threshold intensity (partial ventriculotomy = 2.28 ± 0.55 EDV/s; heart failure = 2.52 ± 1.07 EDV/s; P < 0.0125; P > 0.05 vs change in partial ventriculotomy group). The abnormal responses demonstrated here may contribute to the limited exercise capacity of patients with partial left ventriculotomy despite the improvement in resting left ventricular systolic function.

Effects of sedation during upper gastrointestinal endoscopy on endocrine response and cardiorespiratory function

Upper gastrointestinal endoscopy is often accompanied by tachycardia which is known to be an important pathogenic factor in the development of myocardial ischemia. The pathogenesis of tachycardia is unknown but the condition is thought to be due to the endocrine response to endoscopy. The purpose of the present study was to investigate the effects of sedation on the endocrine response and cardiorespiratory function. Forty patients scheduled for diagnostic upper gastrointestinal endoscopy were randomized into 2 groups. While the patients in the first group did not receive sedation during upper gastrointestinal endoscopy, the patients in the second group were sedated with intravenous midazolam at the dose of 5 mg for those under 65 years or 2.5 mg for those aged 65 years or more. Midazolam was administered by slow infusion. In both groups, blood pressure, ECG tracing, heart rate, and peripheral oxygen saturation (SpO2) were monitored during endoscopy. In addition, blood samples for the determination of cortisol, glucose and C-reactive protein levels were obtained from patients in both groups prior to and following endoscopy. Heart rate and systolic arterial pressure changes were within normal limits in both groups. Comparison of the two groups regarding the values of these two parameters did not reveal a significant difference, while a statistically significant reduction in SpO2 was found in the sedation group. No significant differences in serum cortisol, glucose or C-reactive protein levels were observed between the sedated and non-sedated group. Sedation with midazolam did not reduce the endocrine response and the tachycardia developing during upper gastrointestinal endoscopy, but increased the reduction in SpO2.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effects of social context on endocrine function and Zif268 expression in response to an acute stressor in adolescent and adult rats

There is a paucity of studies comparing social buffering in adolescents and adults, despite their marked differences in social behaviour. I investigated whether greater effects of social buffering on plasma corticosterone concentrations and expression of Zif268 in neural regions after an acute stressor would be found in adolescent compared with adult rats. Samples were obtained before and after one hour of isolation stress and after either one or three hours of recovery back in the colony with either a familiar or unfamiliar cage partner. Adolescent and adult rats did not differ in plasma concentrations of corticosterone at any time point. Corticosterone concentrations were higher after one hour isolation than at baseline (p < 0.001), and rats with a familiar partner during the recovery phase had lower corticosterone concentrations than did rats with an unfamiliar partner (p = 0.02). Zif268 immunoreactive cell counts were higher in the arcuate nucleus in both age groups after isolation (p = 0.007) and higher in the paraventricular nucleus of adolescents compared with adults during the recovery phase irrespective of partner familiarity. There was a significant decrease in immunoreactive cell counts after one hour isolation compared to baseline in the basolateral amygdala, central nucleus of the amygdala, and in the pyramidal layer of the hippocampus (all p < 0.05). An effect of partner familiarity on Zif268 immunoreactive cell counts was found in the granule layer of the dentate gyrus irrespective of age (higher in those with a familiar partner, p = 0.03) and in the medial prefrontal cortex in adolescents (higher with an unfamiliar partner, p = 0.02). Overall, the acute stress and partner familiarity produced a similar pattern of results in adolescents and adults, with both age groups sensitive to the social context.

Dietary Free Oleic and Linoleic Acid Enhances Neutrophil Function and Modulates the Inflammatory Response in Rats

The high ingestion of oleic (OLA) and linoleic (LNA) acids by Western populations, the presence of inflammatory diseases in these populations, and the importance of neutrophils in the inflammatory process led us to investigate the effects of oral ingestion of unesterified OLA and LNA on rat neutrophil function. Pure OLA and LNA were administered by gavage over 10 days. The doses used (0.11, 0.22 and 0.44 g/kg of body weight) were based on the Western consumption of OLA and LNA. Neither fatty acid affected food, calorie or water intake. The fatty acids were not toxic to neutrophils as evaluated by cytometry using propidium iodide (membrane integrity and DNA fragmentation). Neutrophil migration in response to intraperitoneal injection of glycogen and in the air pouch assay, was elevated after administration of either OLA or LNA. This effect was associated with enhancement of rolling and increased release of the chemokine CINC-2 alpha beta. Both fatty acids elevated l-selectin expression, whereas no effect on beta(2)-integrin expression was observed, as evaluated by flow cytometry. LNA increased the production of proinflammatory cytokines (IL-1 beta and CINC-2 alpha beta) by neutrophils after 4 h in culture and both fatty acids decreased the release of the same cytokines after 18 h. In conclusion, OLA and LNA modulate several functions of neutrophils and can influence the inflammatory process.