990 resultados para EPIDERMAL CELLS


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Selektiivisten estrogeenireseptorin muuntelijoiden (serm) vaikutus rintasyöpäsolujen ja luun solujen kuolemaan Selektiiviset estrogeenireseptorin muuntelijat (SERMit) ovat ryhmä kemialliselta rakenteeltaan erilaisia yhdisteitä jotka sitoutuvat solunsisäisiin estrogeenireseptoreihin toimien joko estrogeenin kaltaisina yhdisteinä tai estrogeenin vastavaikuttajina. Tamoksifeeni on SERM –yhdiste, jota on jo pitkään käytetty estrogeenireseptoreita (ER) ilmentävän rintasyövän lääkehoidossa. Tamoksifeeni sekä estää rintasyöpäsolujen jakaantumista että toisaalta aikaansaa niiden apoptoosin eli ohjelmoidun solukuoleman muuntelemalla ER-välitteisesti kohdesolun geenien ilmentymistä. Viimeaikaiset tutkimustulokset ovat kuitenkin osoittaneet tamoksifeenilla olevan myös nopeampia, nongenomisia vaikutusmekanismeja. Tässä väitöskirjatyössä tutkimme niitä nopeita vaikutusmekanismeja joiden avulla tamoksifeeni vaikuttaa rintasyöpäsolujen elinkykyyn. Osoitamme että tamoksifeeni farmakologisina pitoisuuksina aikaansaa nopean mitokondriaalisen solukuolemaan johtavan signallointireitin aktivoitumisen rintasyöpäsoluissa. Tämän lisäksi tutkimme myös tamoksifeenin aiheuttamaan mitokondriovaurioon johtavia tekijöitä. Tutkimustuloksemme osoittavat että ER-positiivisissa rintasyöpäsoluissa tamoksifeeni indusoi pitkäkestoisen ERK-kinaasiaktivaation, joka voidaan estää 17-beta-estradiolilla. Tamoksifeenin aikaansaama nopea solukuolema on pääosin ER:sta riippumaton tapahtuma, mutta siihen voidaan vaikuttaa myös ER-välitteisin mekanismein. Sen sijaan epidermaalisen kasvutekijäreseptorin (EGFR) voitiin osoittaa osallistuvan tamoksifeenin nopeiden vaikutusten välittämiseen. Tämän lisäksi vertailimme myös estradiolin ja eri SERM-yhdisteiden kykyä suojata apoptoosilta käyttämällä osteoblastiperäisiä soluja. Pytyäksemme vertailemaan ER-isotyyppien roolia eri yhdisteiden suojavaikutuksissa, transfektoimme U2OS osteosarkoomasolulinjan ilmentämään pysyvästi joko ERalfaa tai ERbetaa. Tulostemme mukaan sekä estradioli että uusi SERM-yhdiste ospemifeeni suojaavat osteoblastin kaltaisia soluja etoposidi-indusoidulta apoptoosilta. Sekä ERalfa että ERbeta pystyivät välittämään suojavaikutusta, joskin vaikutukset erosivat toisistaan. Lisäksi havaitsimme edellä mainitun suojavaikutuksen olevan yhteydessä muutoksiin solujen sytokiiniekspressiossa. Tietoa SERM-yhdisteiden anti-ja proapoptoottisten vaikutusmekanismeista eri kohdekudoksissa voidaan mahdollisesti hyödyntää kehiteltäessä uusia kudosspesifisiä SERM-yhdisteitä.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The epidermis is the upper layer of the skin and keratinocytes are its most abundant cells. Tight junctions are cell junctions located in the granular layer of the epidermis. They maintain the polarity of the cells and regulate the movement of water-soluble molecules. Epidermal tight junctions may lose their integrity when there are defects in intercellular calcium regulation. Hailey-Hailey and Darier´s disease are dominantly inherited, blistering skin diseases. Hailey-Hailey disease is caused by mutations in the ATP2C1 gene encoding a calcium/manganese ATPase SPCA1 of the Golgi apparatus. Darier´s disease is caused by mutations in the ATP2A2 gene encoding a calcium ATPase SERCA2 of the endoplasmic reticulum. p38 regulates the differentiation of keratinocytes. The overall regulation of epidermal tight junctions is not well understood. The present study examined the regulation of tight junctions in the human epidermis with a focus on calcium ATPases and p38. Skin from Hailey-Hailey and Darier´s disease patients was studied by using immunofluorescence labeling which targeted intercellular junction proteins. Transepidermal water loss was also measured. ATP2C1 gene expression was silenced in cultured keratinocytes, by siRNA, which modeled Hailey-Hailey disease. Expression of intercellular junction proteins was studied at the mRNA and protein levels. Squamous cell carcinoma and normal human keratinocytes were used as a model for impaired and normal keratinocyte differentiation, and the role of p38 isoforms alpha and delta in the regulation of intercellular junction proteins was studied. Both p38 isoforms were silenced by adenovirus cell transduction, chemical inhibitors or siRNA and keratinocyte differentiation was assessed. The results of this thesis revealed that: i.) intercellular junction proteins are expressed normally in acantholytic skin areas of patients with Hailey-Hailey or Darier´s disease but the localization of ZO-1 expanded to the stratum spinosum; ii.) tight junction proteins, claudin-1 and -4, are regulated by ATP2C1 in non-differentiating keratinocytes; and iii.) p38 delta regulates the expression of tight junction protein ZO-1 in proliferating keratinocytes and in squamous cell carcinoma derived cells. ZO-1 silencing, however, did not affect the expression of other tight junction proteins, suggesting that they are differently regulated. This thesis introduces new mechanisms involved in the regulation of tight junctions revealing new interactions. It provides novel evidence linking intracellular calcium regulation and tight junctions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Lung cancer often exhibits molecular changes, such as the overexpression of the ErbB1 gene that encodes epidermal growth factor receptor (EGFR). ErbB1 amplification and mutation are associated with tumor aggressiveness and low response to therapy. The aim of the present study was to design a schedule to synchronize the cell cycle of A549 cell line (a non-small cell lung cancer) and to analyze the possible association between the micronuclei (MNs) and the extrusion of ErbB1 gene extra-copies. After double blocking, by the process of fetal bovine serum deprivation and vincristine treatment, MNs formation was monitored with 5-bromo-2-deoxyuridine (BrdU) incorporation, which is an S-phase marker. Statistical analyses allowed us to infer that MNs may arise both in mitosis as well as in interphase. The MNs were able to replicate their DNA and this process seemed to be non-synchronous with the main cell nuclei. The presence of ErbB1 gene in the MNs was evaluated by fluorescent in situ hybridization (FISH). ErbB1 sequences were detected in the MNs, but a relation between the MNs formation and extrusion of amplified ErbB1could not be established. The present study sought to elucidate the meaning of MNs formation and its association with the elimination of oncogenes or other amplified sequences from the tumor cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Milk fat globule epidermal growth factor 8 (MFG-E8) is an opsonin involved in the phagocytosis of apoptotic cells. In patients with chronic obstructive pulmonary disease (COPD), apoptotic cell clearance is defective. However, whether aberrant MFG-E8 expression is involved in this defect is unknown. In this study, we examined the expression of MFG-E8 in COPD patients. MFG-E8, interleukin (IL)-1β and transforming growth factor (TGF)-β levels were measured in the plasma of 96 COPD patients (93 males, 3 females; age range: 62.12±10.39) and 87 age-matched healthy controls (85 males, 2 females; age range: 64.81±10.11 years) using an enzyme-linked immunosorbent assay. Compared with controls, COPD patients had a significantly lower plasma MFG-E8 levels (P<0.01) and significantly higher plasma TGF-β levels (P=0.002), whereas there was no difference in plasma IL-1β levels between the two groups. Moreover, plasma MFG-E8 levels decreased progressively between Global Initiative for Chronic Obstructive Lung Disease (GOLD) I and GOLD IV stage COPD. Multiple regression analysis showed that the forced expiratory volume in 1 s (FEV1 % predicted) and smoking habit were powerful predictors of MFG-E8 in COPD (P<0.01 and P=0.026, respectively). MFG-E8 was positively associated with the FEV1 % predicted and negatively associated with smoking habit. The area under the receiver operating characteristic curve was 0.874 (95% confidence interval: 0.798-0.95; P<0.01). Our findings demonstrated the utility of MFG-E8 as a marker of disease severity in COPD and that cigarette smoke impaired MFG-E8 expression in these patients.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Nous avons récemment démontré que les espèces réactives oxygénées induisent une augmentation de l’expression des protéines Giα dans les cellules du muscle lisse vasculaire (CMLV) provenant d’aortes de rats spontanément hypertendus (SHR, de l’anglais spontaneously hypertensive rats). La présente étude a pour but d’étudier les effets du peroxyde d’hydrogène (H2O2), un oxydant qui induit le stress oxydatif, sur l’expression de Giα et sur l’activité de l’adénylate cyclase, et d’explorer les voies de signalisation sous-jacentes responsables de cette réponse. Nos résultats montrent que H2O2 induit une augmentation de l’expression des protéines Giα-2 et Giα-3 de manière dose- et temps-dépendante avec une augmentation maximale de 40-50% à 100 µM après 1 heure, sans affecter l’expression de Gsα. L’expression des protéines Giα a été maintenue au niveau normal en presence de AG 1478, AG1295, PD98059 et la wortmannine, des inhibiteurs d’EGF-R (de l’anglais epidermal growth factor receptor), PDGFR-β (de l’anglais platelet-derived growth factor receptor β), de la voie de signalisation ras-ERK1/2 (de l’anglais extracellular regulated kinase1/2), et de la voie de la PI3Kinase-AKT (de l’anglais phosphatidyl inositol-3 kinase), respectivement. En outre, le traitement des CMLV avec H2O2 a induit une augmentation du degré de phosphorylation d’EGF-R, PDGF-R, ERK1/2 et AKT; et cette expression a été maintenue au niveau témoin par leurs inhibiteurs respectifs. Les inhibiteurs d’EGF-R et PDGF-R ont aussi induit une diminution du degré de phosphorylation de ERK1/2, et AKT/PKB. En outre, la transfection des cellules avec le siRNA (de l’anglais, small interfering ribonucleic acid) de EGF-R et PDGFR-β a atténué la surexpression des protéines Giα-2 et Giα-3 induite par le traitement au H2O2. La surexpression des protéines Giα induite par H2O2 a été corrélée avec une augmentation de la fonction de la protéine Giα. L’inhibition de l’activité de l’adénylate cyclase par de faibles concentrations de GTPγS après stimulation par la forskoline a augmenté de 20% dans les cellules traitées au H2O2. En outre, le traitement des CMLV au H2O2 a aussi accru l’inhibition de l’activité de l’adénylate cyclase par les hormones inhibitrices telles que l’angiotensine II, oxotrémorine et C-ANP4-23. D’autre part, la stimulation de l’adénylate cyclase induite par GTPγS, glucagon, isoprotérénol, forskoline, et le fluorure de sodium (NaF) a été atténuée de façon significative dans les cellules traitées au H2O2. Ces résultats suggèrent que H2O2 induit la surexpression des protéines Giα-2 and Giα-3 via la transactivation des récepteurs des facteurs de croissance EGF-R, PDGFR-β et l’activation des voies de signalisation ras-ERK1/2 et PI3K-AKT Mot-cles: Protéines Giα, peroxyde d’hydrogène, stress oxydant, récepteurs des facteurs de croissance, MAP kinases, adénylate cyclase, hypertension

Relevância:

30.00% 30.00%

Publicador:

Resumo:

ADP-ribosylation factor-1 (ARF1) est une petite GTPase principalement connue pour son rôle dans la formation de vésicules au niveau de l’appareil de Golgi. Récemment, dans des cellules de cancer du sein, nous avons démontré qu’ARF1 est aussi un médiateur important de la signalisation du récepteur du facteur de croissance épidermique (EGFR) contrôlant la prolifération, la migration et l'invasion cellulaire. Cependant, le mécanisme par lequel l’EGFR active la GTPase ainsi que le rôle de cette dernière dans la régulation de la fonction du récepteur demeure inconnue. Dans cette thèse, nous avions comme objectifs de définir le mécanisme d'activation de ARF1 dans les cellules de cancer du sein hautement invasif et démontrer que l’activation de cette isoforme de ARF joue un rôle essentiel dans la résistance de ces cellules aux inhibiteurs de l'EGFR. Nos études démontrent que les protéines d’adaptatrices Grb2 et p66Shc jouent un rôle important dans l'activation de ARF1. Alors que Grb2 favorise le recrutement d’ARF1 à l'EGFR ainsi que l'activation de cette petite GTPase, p66Shc inhibe le recrutement du complexe Grb2-ARF1 au récepteur et donc contribue à limiter l’activation d’ARF1. De plus, nous démontrons que ARF1 favorise la résistance aux inhibiteurs des tyrosines kinases dans les cellules de cancer du sein hautement invasif. En effet, une diminution de l’expression de ARF1 a augmenté la sensibilité descellules aux inhibiteurs de l'EGFR. Nous montrons également que de hauts niveaux de ARF1 contribuent à la résistance des cellules à ces médicaments en améliorant la survie et les signaux prolifératifs à travers ERK1/2, Src et AKT, tout en bloquant les voies apoptotiques (p38MAPK et JNK). Enfin, nous mettons en évidence le rôle de la protéine ARF1 dans l’apoptose en réponse aux traitements des inhibiteurs de l’EGFR. Nos résultats indiquent que la dépletion d’ARF1 promeut la mort cellulaire induite par gefitinib, en augmentant l'expression de facteurs pro-apoptotiques (p66shc, Bax), en altérant le potentiel de la membrane mitochondriale et la libération du cytochrome C. Ensemble, nos résultats délimitent un nouveau mécanisme d'activation de ARF1 dans les cellules du cancer du sein hautement invasif et impliquent l’activité d’ARF1 comme un médiateur important de la résistance aux inhibiteurs EGFR.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The COE/EBF gene family marks a subset of prospective neurons in the vertebrate central and peripheral. nervous system; including neurons deriving from some ectodermal placodes. Since placodes are often considered unique to vertebrates, we have characterised an amphioxus COE/EBF gene with the aim of using it as a marker to examine the timing and location of peripheral neuron differentiation. A single COE/EBF family member, AmphiCoe, was isolated from the amphioxus Branchiostoma floridae: AmphiCoe lies basal to the vertebrate COE/EBF genes in molecular phylogenetic analysis, suggesting that the duplications that formed the vertebrate COE/EBF family were specific to the vertebrate lineage. AmphiCoe is expressed in the central nervous system and in a small number of scattered ectodermal cells on the flanks of neurulae stage embryos. These cells become at least largely recessed beneath the ectoderm. Scanning electron microscopy was used to examine embryos in which the ectoderm had been partially peeled away. This revealed that these cells have neuronal morphology, and we infer that they are the precursors of epidermal primary sensory neurons. These characters lead us to suggest that differentiation of some ectodermal cells into sensory neurons with a tendency to sink beneath the embryonic surface represents a primitive feature that has become incorporated into placodes during vertebrate evolution. (C) 2004 Wiley-Liss, Inc.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective was to investigate the potential role of the oocyte in modulating proliferation and basal, FSH-induced and insulin-like growth factor (IGF)-induced secretion of inhibin A (inh A), activin A (act A), follistatin (FS), estradiol (E-2), and progesterone (P-4) by mural bovine granulosa cells. Cells from 4- to 6-mm follicles were cultured in serum-free medium containing insulin and androstenedione, and the effects of ovine FSH and IGF analogue (LR3-IGF-1) were tested alone and in the presence of denuded bovine oocytes (2, 8, or 20 per well). Medium was changed every 48 h, cultures were terminated after 144 h, and viable cell number was determined. Results are based on combined data from four independent cultures and are presented for the last time period only when responses were maximal. Both FSH and IGF increased (P < 0.001) secretion of inh A, act A, FS, E-2, and P-4 and raised cell number. In the absence of FSH or IGF, coculture with oocytes had no effect on any of the measured hormones, although cell number was increased up to 1.8-fold (P < 0.0001). Addition of oocytes to FSH-stimulated cells dose-dependently suppressed (P < 0.0001) inh A (6-fold maximum suppression), act A (5.5-fold), FS (3.6-fold), E-2 (4.6-fold), and P-4 (2.4-fold), with suppression increasing with FSH dose. Likewise, oocytes suppressed (P < 0.001) IGF-induced secretion of inh A, act A, FS, and E-2 (P < 0.05) but enhanced IGF-induced P-4 secretion (1.7-fold; P < 0.05). Given the similarity of these oocyte-mediated actions to those we observed previously following epidermal growth factor (EGF) treatment, we used immunocytochemistry to determine whether bovine oocytes express EGF or transforming growth factor (TGF) alpha. Intense staining with TGFalpha antibody (but not with EGF antibody) was detected in oocytes both before and after coculture. Experiments involving addition of TGFalpha to granulosa cells confirmed that the peptide mimicked the effects of oocytes on cell proliferation and on FSH- and IGF-induced hormone secretion. These experiments indicate that bovine oocytes secrete a factor(s) capable of modulating granulosa cell proliferation and responsiveness to FSH and IGF in terms of steroidogenesis and production of inhibin-related peptides, bovine oocytes express TGFalpha but not EGF, and TGFalpha is a prime candidate for mediating the actions of oocytes on bovine granulosa cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Treatment of murine Swiss 3T3 fibroblasts and XB/2 keratinocytes with UV-B light (302 nm) resulted in a dose-dependent inhibition of [125I] epidermal growth factor (EGF) binding. The light dose required to achieve 50% inhibition of binding in both cell types was 80–85 J/m2 Decreased [125I] platelet-derived growth factor binding was not evoked even by light doses of up to 280 J/m2 UV-B irradiation did not stimultate phosphorylation of the 80 kd protein substrate for protein kinase C. Furthermore, its effect on [125I]EGF binding was not altered as a consequence of protein kinase C down-regulation following prolonged exposure of cells to phorbol esters. These results indicate that UV-B-induced transmodulation of the epidermal growth factor receptor is a specific event mediated through a protein kinase C-indepen dent pathway. Transfer of culture medium from irradiated cells to untreated control cells showed this effect was not induced as a result of transforming growth factor α release and subsequent binding to the EGF receptor in these cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sapintoxin A (SAP A) and 12-deoxyphorbol 13-phenylacetate (DOPP), are two biologically active but non-turnour-promoting phorbol esters that potently bind to and activate the phorbol ester receptor, protein kinase C (PKC). SAP A and DOPP cause a dose-dependent increase in the phosphorylation of an 80 kd (80K) substrate protein for PKC in Swiss 3T3 cells. A similar dose—response effect was seen with sapintoxin D (SAP D), the stage 2 promoting analogue of 12-O-tetradecanoylphorbol-13-acetate and the complete promoter phorbol 12,13-dibutyrate (PDB). The doses resulting in a half maximal phosphorylation of this protein (Ka were 20 nM (SAP A), 45 nM (DOPP), 23 nM (SAP D) and 37 nM (PDB). Both non-promoting and phorbol esters induced a dose-dependent inhibition of [125I]epidermal growth factor (EGF) binding to its receptor in Swiss 3T3 cells. The doses required for 50% inhibition of binding (Ki) were: 8 nM (SAP A), 16 nM (DOPP), 14 nM (SAP D) and 17 nM (PDB). The results clearly demonstrate that induction of phosphorylation of the Pu 80K phosphoprotein and inhibition of [125I]EGF binding in Swiss 3T3 cells following exposure to phorbol esters is independent of the tumour-promoting activity of these compounds. The fact that SAP A, DOPP, SAP D and PDB are mitogenic for a variety of cell types and that exposure to these compounds leads to 80K phosphorylation and inhibition of [125I]EGF binding, suggests that these early biological events may play a role in the mitogenic response induced by these compounds.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Single-cell analysis is essential for understanding the processes of cell differentiation and metabolic specialisation in rare cell types. The amount of single proteins in single cells can be as low as one copy per cell and is for most proteins in the attomole range or below; usually considered as insufficient for proteomic analysis. The development of modern mass spectrometers possessing increased sensitivity and mass accuracy in combination with nano-LC-MS/MS now enables the analysis of single-cell contents. In Arabidopsis thaliana, we have successfully identified nine unique proteins in a single-cell sample and 56 proteins from a pool of 15 single-cell samples from glucosinolate-rich S-cells by nanoLC-MS/MS proteomic analysis, thus establishing the proof-of-concept for true single-cell proteomic analysis. Dehydrin (ERD14_ARATH), two myrosinases (BGL37_ARATH and BGL38_ARATH), annexin (ANXD1_ARATH), vegetative storage proteins (VSP1_ARATH and VSP2_ARATH) and four proteins belonging to the S-adenosyl-l-methionine cycle (METE_ARATH, SAHH1_ARATH, METK4_ARATH and METK1/3_ARATH) with associated adenosine kinase (ADK1_ARATH), were amongst the proteins identified in these single-S-cell samples. Comparison of the functional groups of proteins identified in S-cells with epidermal/cortical cells and whole tissue provided a unique insight into the metabolism of S-cells. We conclude that S-cells are metabolically active and contain the machinery for de novo biosynthesis of methionine, a precursor for the most abundant glucosinolate glucoraphanine in these cells. Moreover, since abundant TGG2 and TGG1 peptides were consistently found in single-S-cell samples, previously shown to have high amounts of glucosinolates, we suggest that both myrosinases and glucosinolates can be localised in the same cells, but in separate subcellular compartments. The complex membrane structure of S-cells was reflected by the presence of a number of proteins involved in membrane maintenance and cellular organisation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Plant cell growth and stress signaling require Ca2+ influx through plasma membrane transport proteins that are regulated by reactive oxygen species. In root cell growth, adaptation to salinity stress, and stomatal closure, such proteins operate downstream of the plasma membrane NADPH oxidases that produce extracellular superoxide anion, a reactive oxygen species that is readily converted to extracellular hydrogen peroxide and hydroxyl radicals, OH_. In root cells, extracellular OH_ activates a plasma membrane Ca2+-permeable conductance that permits Ca2+ influx. In Arabidopsis thaliana, distribution of this conductance resembles that of annexin1 (ANN1). Annexins are membrane binding proteins that can form Ca2+-permeable conductances in vitro. Here, the Arabidopsis loss-of-function mutant for annexin1 (Atann1) was found to lack the root hair and epidermal OH_-activated Ca2+- and K+-permeable conductance. This manifests in both impaired root cell growth and ability to elevate root cell cytosolic free Ca2+ in response to OH_. An OH_-activated Ca2+ conductance is reconstituted by recombinant ANN1 in planar lipid bilayers. ANN1 therefore presents as a novel Ca2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca2+ in plants.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Neural stem cells (NSCs) are potential sources for cell therapy of neurodegenerative diseases and for drug screening. Despite their potential benefits, ethical and practical considerations limit the application of NSCs derived from human embryonic stem cells (ES) or adult brain tissue. Thus, alternative sources are required to satisfy the criteria of ready accessibility, rapid expansion in chemically defined media and reliable induction to a neuronal fate. We isolated somatic stem cells from the human periodontium that were collected during minimally invasive periodontal access flap surgery as part of guided tissue regeneration therapy. These cells could be propagated as neurospheres in serum-free medium, which underscores their cranial neural crest cell origin. Culture in the presence of epidermal growth factor (EGF) and fibroblast growth factor-2 (FGF-2) under serum-free conditions resulted in large numbers of nestin-positive/Sox-2-positive NSCs. These periodontium-derived (pd) NSCs are highly proliferative and migrate in response to chemokines that have been described as inducing NSC migration. We used immunocytochemical techniques and RT-PCR analysis to assess neural differentiation after treatment of the expanded cells with a novel induction medium. Adherence to substrate, growth factor deprivation, and retinoic acid treatment led to the acquisition of neuronal morphology and stable expression of markers of neuronal differentiation by more than 90% of the cells. Thus, our novel method might provide nearly limitless numbers of neuronal precursors from a readily accessible autologous adult human source, which could be used as a platform for further experimental studies and has potential therapeutic implications.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Somatic neural and neural crest stem cells are promising sources for cellular therapy of several neurodegenerative diseases. However, because of practical considerations such as inadequate accessibility of the source material, the application of neural crest stem cells is strictly limited. The secondary palate is a highly regenerative and heavily innervated tissue, which develops embryonically under direct contribution of neural crest cells. Here, we describe for the first time the presence of nestin-positive neural crest-related stem cells within Meissner corpuscles and Merkel cell-neurite complexes located in the hard palate of adult Wistar rats. After isolation, palatal neural crest-related stem cells (pNC-SCs) were cultivated in the presence of epidermal growth factor and fibroblast growth factor under serum-free conditions, resulting in large amounts of neurospheres. We used immunocytochemical techniques and reverse transcriptase-polymerase chain reaction to assess the expression profile of pNC-SCs. In addition to the expression of neural crest stem cell markers such as Nestin, Sox2, and p75, we detected the expression of Klf4, Oct4, and c-Myc. pNC-SCs differentiated efficiently into neuronal and glial cells. Finally, we investigated the potential expression of stemness markers within the human palate. We identified expression of stem cell markers nestin and CD133 and the transcription factors needed for reprogramming of somatic cells into pluripotent cells: Sox2, Oct4, Klf4, and c-Myc. These data show that cells isolated from palatal rugae form neurospheres, are highly plastic, and express neural crest stem cell markers. In addition, pNC-SCs may have the ability to differentiate into functional neurons and glial cells, serving as a starting point for therapeutic studies.