986 resultados para Complementary DNA library
Resumo:
Some sites of extrapulmonary tuberculosis and focal complications of brucellosis are very difficult to differentiate clinically, radiologically, and even histopathologically. Conventional microbiological methods for the diagnosis of extrapulmonary tuberculosis and complicated brucellosis not only lack adequate sensitivity, they are also time consuming, which could lead to an unfavourable prognosis. The aim of this work was to develop a multiplex real-time PCR assay based on SYBR Green I to simultaneously detect Brucella spp and Mycobacterium tuberculosis complex and evaluate the efficacy of the technique with different candidate genes. The IS711, bcsp31 and omp2a genes were used for the identification of Brucella spp and the IS6110, senX3-regX3 and cfp31 genes were targeted for the detection of the M. tuberculosis complex. As a result of the different combinations of primers, nine different reactions were evaluated. A test was defined as positive only when the gene combinations were capable of co-amplifying both pathogens in a single reaction tube and showed distinguishable melting temperatures for each microorganism. According to the melting analysis, only three combinations of amplicons (senX3-regX3+bcsp31, senX3-regX3+IS711 and IS6110+IS711) were visible. Detection limits of senX3-regX3+bcsp31 and senX3-regX3+IS711 were of 2 and 3 genome equivalents for M. tuberculosis complex and Brucella while for IS6110+IS711 they were of 200 and 300 genome equivalents, respectively. The three assays correctly identified all the samples, showing negative results for the control patients. The presence of multicopy elements and GC content were the components most influencing the efficiency of the test; this should be taken into account when designing a multiplex-based SYBR Green I assay. In conclusion, multiplex real time PCR assays based on the targets senX3-regX3+bcsp31 and senX3-regX3+IS711 using SYBR Green I are highly sensitive and reproducible. This may therefore be a practical approach for the rapid differential diagnosis between extrapulmonary tuberculosis and complicated brucellosis.
Resumo:
Connexin36 (Cx36) is specifically expressed in neurons and in pancreatic beta-cells. Cx36 functions as a critical regulator of insulin secretion and content in beta-cells. In order to identify the molecular mechanisms that control the beta-cell expression of Cx36, we initiated the characterization of the human 5' regulatory region of the CX36 gene. A 2043-bp fragment of the human CX36 promoter was identified from a human BAC library and fused to a luciferase reporter gene. This promoter region was sufficient to confer specific expression to the reporter gene in insulin-secreting cell lines. Within this 5' regulatory region, a putative neuron-restrictive silencer element conserved between rodent and human species was recognized and binds the neuron-restrictive silencing factor (NRSF/REST). This factor is not expressed in insulin-secreting cells and neurons; it functions as a potent repressor through the recruitment of histone deacetylase to the promoter of neuronal genes. The NRSF-mediated repression of Cx36 in HeLa cells was abolished by trichostatin A, confirming the functional importance of histone deacetylase activity. Ectopic expression, by viral gene transfer, of NRSF/REST in different insulin-secreting beta-cell lines induced a marked reduction in Cx36 mRNA and protein content. Moreover, mutations in the Cx36 neuron-restrictive silencer element relieved the low transcriptional activity of the human CX36 promoter observed in HeLa cells and in INS-1 cells expressing NRSF/REST. The data showed that cx36 gene expression in insulin-producing beta-cell lines is strictly controlled by the transcriptional repressor NRSF/REST indicating that Cx36 participates to the neuronal phenotype of the pancreatic beta-cells.
Resumo:
Dilatation of the ascending aorta (AAD) is a prevalent aortopathy that occurs frequently associated with bicuspid aortic valve (BAV), the most common human congenital cardiac malformation. The molecular mechanisms leading to AAD associated with BAV are still poorly understood. The search for differentially expressed genes in diseased tissue by quantitative real-time PCR (qPCR) is an invaluable tool to fill this gap. However, studies dedicated to identify reference genes necessary for normalization of mRNA expression in aortic tissue are scarce. In this report, we evaluate the qPCR expression of six candidate reference genes in tissue from the ascending aorta of 52 patients with a variety of clinical and demographic characteristics, normal and dilated aortas, and different morphologies of the aortic valve (normal aorta and normal valve n = 30; dilated aorta and normal valve n = 10; normal aorta and BAV n = 4; dilated aorta and BAV n = 8). The expression stability of the candidate reference genes was determined with three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable genes for the three algorithms employed were CDKN1β, POLR2A and CASC3, independently of the structure of the aorta and the valve morphology. In conclusion, we propose the use of these three genes as reference genes for mRNA expression analysis in human ascending aorta. However, we suggest searching for specific reference genes when conducting qPCR experiments with new cohort of samples.
Resumo:
The Tax protein of the human T-cell leukemia virus type 1 (HTLV-1) has been implicated in human T-cell immortalization. The primary function of Tax is to transcriptionally activate the HTLV-1 promoter, but Tax is also known to stimulate expression of cellular genes. It has been reported to associate with several transcription factors, as well as proteins not involved in transcription. To better characterize potential cellular targets of Tax present in infected cells, a Saccharomyces cerevisiae two-hybrid screening was performed with a cDNA library constructed from the HTLV-1-infected MT2 cell line. From this study, we found 158 positive clones representing seven different cDNAs. We focused our attention on the cDNA encoding the transcription factor CREB-2. CREB-2 is an unconventional member of the ATF/CREB family in that it lacks a protein kinase A (PKA) phosphorylation site and has been reported to negatively regulate transcription from the cyclic AMP response element of the human enkephalin promoter. In this study, we demonstrate that CREB-2 cooperates with Tax to enhance viral transcription and that its basic-leucine zipper C-terminal domain is required for both in vitro and in vivo interactions with Tax. Our results confirm that the activation of the HTLV-1 promoter through Tax and factors of the ATF/CREB family is PKA independent.
Resumo:
Islet-brain 1 (IB1) is the human and rat homologue of JIP-1, a scaffold protein interacting with the c-Jun amino-terminal kinase (JNK). IB1 expression is mostly restricted to the endocrine pancreas and to the central nervous system. Herein, we explored the transcriptional mechanism responsible for this preferential islet and neuronal expression of IB1. A 731-bp fragment of the 5' regulatory region of the human MAPK8IP1 gene was isolated from a human BAC library and cloned upstream of a luciferase reporter gene. This construct drove high transcriptional activity in both insulin-secreting and neuron-like cells but not in unrelated cell lines. Sequence analysis of this promoter region revealed the presence of a neuron-restrictive silencer element (NRSE) known to bind repressor zinc finger protein REST. This factor is not expressed in insulin-secreting and neuron-like cells. By mobility shift assay, we confirmed that REST binds to the NRSE present in the IB1 promoter. Once transiently transfected in beta-cell lines, the expression vector encoding REST repressed IB1 transcriptional activity. The introduction of a mutated NRSE in the 5' regulating region of the IB1 gene abolished the repression activity driven by REST in insulin-secreting beta cells and relieved the low transcriptional activity of IB1 observed in unrelated cells. Moreover, transfection in non-beta and nonneuronal cell lines of an expression vector encoding REST lacking its transcriptional repression domain relieved IB1 promoter activity. Last, the REST-mediated repression of IB1 could be abolished by trichostatin A, indicating that deacetylase activity is required to allow REST repression. Taken together, these data establish a critical role for REST in the control of the tissue-specific expression of the human IB1 gene.
Resumo:
Orphan receptors of the FTZ-F1-related group of nuclear receptors (xFF1r) were identified in Xenopus laevis by isolation of cDNAs from a neurula stage library. Two cDNAs were found, which encode full length, highly related receptor proteins, xFF1rA and B, whose closet relative known so far is the murine LRH-1 orphan receptor. xFF1rA protein expressed by a recombinant vaccinia virus system specifically binds to FTZ-F1 response elements (FRE; PyCAAGGPyCPu). In cotransfection studies, xFF1rA constitutively activates transcription, in a manner dependent on the number of FREs. The amounts of at least four mRNAs encoding full-length receptors greatly increase between gastrula and early tailbud stages and decrease at later stages. At early tailbud stages, xFTZ-F1-related antigens are found in all nuclei of the embryo.
Resumo:
DNA that survives in museum specimens, bones and other tissues recovered by archaeologists is invariably fragmented and chemically modified. The extent to which such modifications accumulate over time is largely unknown but could potentially be used to differentiate between endogenous old DNA and present-day DNA contaminating specimens and experiments. Here we examine mitochondrial DNA sequences from tissue remains that vary in age between 18 and 60,000 years with respect to three molecular features: fragment length, base composition at strand breaks, and apparent C to T substitutions. We find that fragment length does not decrease consistently over time and that strand breaks occur preferentially before purine residues by what may be at least two different molecular mechanisms that are not yet understood. In contrast, the frequency of apparent C to T substitutions towards the 5'-ends of molecules tends to increase over time. These nucleotide misincorporations are thus a useful tool to distinguish recent from ancient DNA sources in specimens that have not been subjected to unusual or harsh treatments.
Resumo:
Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.
Resumo:
Homologous recombination is important for the repair of double-strand breaks during meiosis. Eukaryotic cells require two homologs of Escherichia coli RecA protein, Rad51 and Dmc1, for meiotic recombination. To date, it is not clear, at the biochemical level, why two homologs of RecA are necessary during meiosis. To gain insight into this, we purified Schizosaccharomyces pombe Rad51 and Dmc1 to homogeneity. Purified Rad51 and Dmc1 form homo-oligomers, bind single-stranded DNA preferentially, and exhibit DNA-stimulated ATPase activity. Both Rad51 and Dmc1 promote the renaturation of complementary single-stranded DNA. Importantly, Rad51 and Dmc1 proteins catalyze ATP-dependent strand exchange reactions with homologous duplex DNA. Electron microscopy reveals that both S. pombe Rad51 and Dmc1 form nucleoprotein filaments. Rad51 formed helical nucleoprotein filaments on single-stranded DNA, whereas Dmc1 was found in two forms, as helical filaments and also as stacked rings. These results demonstrate that Rad51 and Dmc1 are both efficient recombinases in lower eukaryotes and reveal closer functional and structural similarities between the meiotic recombinase Dmc1 and Rad51. The DNA strand exchange activity of both Rad51 and Dmc1 is most likely critical for proper meiotic DNA double-strand break repair in lower eukaryotes.
Resumo:
The action of individual type II DNA topoisomerases has been followed in real time by observing the elastic response of single DNA molecules to sequential strand passage events. Micromanipulation methods provide a complementary approach to biochemical studies for investigating the mechanism of DNA topoisomerases.
Resumo:
Transcriptional activity relies on coregulators that modify the chromatin structure and serve as bridging factors between transcription factors and the basal transcription machinery. Using the DE domain of human peroxisome proliferator-activated receptor gamma (PPARgamma) as bait in a yeast two-hybrid screen of a human adipose tissue library, we isolated the scaffold attachment factor B1 (SAFB1/HET/HAP), which was previously shown to be a corepressor of estrogen receptor alpha. We show here that SAFB1 has a very broad tissue expression profile in human and is also expressed all along mouse embryogenesis. SAFB1 interacts in pull-down assays not only with PPARgamma but also with all nuclear receptors tested so far, albeit with different affinities. The association of SAFB1 and PPARgamma in vivo is further demonstrated by fluorescence resonance energy transfer (FRET) experiments in living cells. We finally show that SAFB1 is a rather general corepressor for nuclear receptors. Its change in expression during the early phases of adipocyte and enterocyte differentiation suggests that SAFB1 potentially influences cell proliferation and differentiation decisions.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Rapid amplification of cDNA ends (RACE) is a widely used approach for transcript identification. Random clone selection from the RACE mixture, however, is an ineffective sampling strategy if the dynamic range of transcript abundances is large. To improve sampling efficiency of human transcripts, we hybridized the products of the RACE reaction onto tiling arrays and used the detected exons to delineate a series of reverse-transcriptase (RT)-PCRs, through which the original RACE transcript population was segregated into simpler transcript populations. We independently cloned the products and sequenced randomly selected clones. This approach, RACEarray, is superior to direct cloning and sequencing of RACE products because it specifically targets new transcripts and often results in overall normalization of transcript abundance. We show theoretically and experimentally that this strategy leads indeed to efficient sampling of new transcripts, and we investigated multiplexing the strategy by pooling RACE reactions from multiple interrogated loci before hybridization.
Resumo:
The RNA genome of the human T-cell leukemia virus type 1 (HTLV-1) codes for proteins involved in infectivity, replication, and transformation. We report in this study the characterization of a novel viral protein encoded by the complementary strand of the HTLV-1 RNA genome. This protein, designated HBZ (for HTLV-1 bZIP factor), contains a N-terminal transcriptional activation domain and a leucine zipper motif in its C terminus. We show here that HBZ is able to interact with the bZIP transcription factor CREB-2 (also called ATF-4), known to activate the HTLV-1 transcription by recruiting the viral trans-activator Tax on the Tax-responsive elements (TxREs). However, we demonstrate that the HBZ/CREB-2 heterodimers are no more able to bind to the TxRE and cyclic AMP response element sites. Taking these findings together, the functional inactivation of CREB-2 by HBZ is suggested to contribute to regulation of the HTLV-1 transcription. Moreover, the characterization of a minus-strand gene protein encoded by HTLV-1 has never been reported until now.