961 resultados para Chromosomes, Human, Pair 20


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A sensitive, selective, and reproducible in-tube solid-phase microextraction and liquid chromatographic (in-tube SPME/LC-UV) method for simultaneous determination of mirrazapine, citalopram, paroxetine, duloxetine, fluoxetine, and sertraline in human plasma was developed, validated and further applied to the analysis of plasma samples from elderly patients undergoing therapy with antidepressants. Important factors in the optimization of in-tube SPME efficiency are discussed, including the sample draw/eject volume, draw/eject cycle number, draw/eject flow-rate, sample pH, and influence of plasma proteins. The quantification limits of the in-tube SPME/LC method varied between 20 and 50 ng/mL, with a coefficient of variation lower than 10%. The response of the in-tube SPME/LC method for most of the drugs was linear over a dynamic range from 50 to 500 ng/mL, with correlation coefficients higher than 0.9985. The in-tube SPME/LC can be successfully used to analyze plasma samples from ageing patients undergoing therapy with nontricyclic antidepressants. (c) 2007 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The total deposition of environmental tobacco smoke (ETS), diesel and petrol smoke in the respiratory tract of 14 non-smokers between the ages of 20 and 30 was determined experimentally. A scanning mobility particle sizer (SMPS) measuring a size range of 0.016-0.626 mu m was used to characterise the inhaled and exhaled aerosol during relaxed nasal breathing over a period of 10 min. The ETS, diesel, and petrol particles had average count median diameter (and geometric standard deviation) of 0.183 mu m (1.7), 0.125 mu m (1.7), and 0.069 mu m (1.7), respectively. The average total number deposition of ETS was 36% (standard deviation 10%), of diesel smoke 30% (standard deviation 9%), and of petrol smoke 41% (standard deviation 8%). The analysis of the deposition patterns as a function of particle size for the three aerosols in each individual showed that there is a significant difference between each aerosol for a majority of individuals (12 out of 14). This is an important result as it indicates that differences persist regardless of inter-subject variability. (C) 2005 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In ascending aorta aneurysms, there is an enlargement of the whole vessel, whereas aortic dissections (ADs) are characterized by the cleavage of the wall into 2 sheets at the external half. We searched if alterations in collagen could be related to these diseases. Sections of aortas from 14 case patients with acute dissections, 10 case patients with aneurysms, and 9 control subjects were stained with picrosirius. Slides were analyzed under polarized microscopy to evaluate the structure of collagen fibers. The proportion of collagen was calculated in each half of the medial layer by color detection in a computerized image analysis system. Collagen appearance under polarized light was consistent with collagenolysis. The mean collagen proportions at the inner and outer halves, respectively, were 0.50 +/- 0.13 and 0.40 +/- 0.08 in the control group, 0.20 +/- 0.10 and 0.18 +/- 0.12 in the AD group, and 0.33 +/- 0.12 and 0.19 +/- 0.12 in the aneurysm group. The AD (P < .01) and control (P = .04) groups had less collagen at the external half, no difference was found in the aneurysm group (P = .71). In both halves, there was less collagen in the case patients than in the control subjects (all P < .01), but at the internal half, the decrease was significantly greater in the case patients with aneurysms than in those with dissections (P = .03; at the external half, P = .99). Aortic dissections and aneurysms show a decrease in collagen content that could be related to a weakness of the wall underlying the diseases, but the locations of the decrease differ: in dissections, it is situated mostly at the external portion of the media (site of cleavage), whereas in aneurysms, it is more diffuse, consistent with the global enlargement. (c) 2008 Elsevier Inc. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aneas I, Rodrigues MV, Pauletti BA, Silva GJ, Carmona R, Cardoso L, Kwitek AE, Jacob HJ, Soler JM, Krieger JE. Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR. Physiol Genomics 37: 52-57, 2009. First published January 6, 2009; doi: 10.1152/physiolgenomics.90299.2008. - To dissect the genetic architecture controlling blood pressure (BP) regulation in the spontaneously hypertensive rat (SHR) we derived congenic rat strains for four previously mapped BP quantitative trait loci (QTLs) in chromosomes 2, 4, and 16. Target chromosomal regions from the Brown Norway rat (BN) averaging 13 - 29 cM were introgressed by marker-assisted breeding onto the SHR genome in 12 or 13 generations. Under normal salt intake, QTLs on chromosomes 2a, 2c, and 4 were associated with significant changes in systolic BP (13, 20, and 15 mmHg, respectively), whereas the QTL on chromosome 16 had no measurable effect. On high salt intake (1% NaCl in drinking water for 2 wk), the chromosome 16 QTL had a marked impact on SBP, as did the QTLs on chromosome 2a and 2c (18, 17, and 19 mmHg, respectively), but not the QTL on chromosome 4. Thus these four QTLs affected BP phenotypes differently: 1) in the presence of high salt intake (chromosome 16), 2) only associated with normal salt intake (chromosome 4), and 3) regardless of salt intake (chromosome 2c and 2a). Moreover, salt sensitivity was abrogated in congenics SHR. BN2a and SHR. BN16. Finally, we provide evidence for the influence of genetic background on the expression of the mapped QTLs individually or as a group. Collectively, these data reveal previously unsuspected nuances of the physiological roles of each of the four mapped BP QTLs in the SHR under basal and/or salt loading conditions unforeseen by the analysis of the F2 cross.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Resting state functional magnetic resonance imaging (fMRI) reveals a distinct network of correlated brain function representing a default mode state of the human brain The underlying structural basis of this functional connectivity pattern is still widely unexplored We combined fractional anisotropy measures of fiber tract integrity derived from diffusion tensor imaging (DTI) and resting state fMRI data obtained at 3 Tesla from 20 healthy elderly subjects (56 to 83 years of age) to determine white matter microstructure e 7 underlying default mode connectivity We hypothesized that the functional connectivity between the posterior cingulate and hippocampus from resting state fMRI data Would be associated with the white matter microstructure in the cingulate bundle and fiber tracts connecting posterior cingulate gyrus With lateral temporal lobes, medial temporal lobes, and precuneus This was demonstrated at the p<0001 level using a voxel-based multivariate analysis of covariance (MANCOVA) approach In addition, we used a data-driven technique of joint independent component analysis (ICA) that uncovers spatial pattern that are linked across modalities. It revealed a pattern of white matter tracts including cingulate bundle and associated fiber tracts resembling the findings from the hypothesis-driven analysis and was linked to the pattern of default mode network (DMN) connectivity in the resting state fMRI data Out findings support the notion that the functional connectivity between the posterior cingulate and hippocampus and the functional connectivity across the entire DMN is based oil distinct pattern of anatomical connectivity within the cerebral white matter (C) 2009 Elsevier Inc All rights reserved

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The taxane docetaxel is currently the most effective chemotherapeutic drug for the treatment of advanced breast cancer. However, a considerable proportion of breast cancer patients do not respond positively to docetaxel. The mechanisms of docetaxel resistance are poorly understood. Overexpression of ERBB2 occurs in 15-30% of breast tumors and is associated with chemoresistance to a variety of anticancer drugs. In the present study, we sought to identify genes involved in ERBB2-mediated chemoresistance to docetaxel. We generated SAGE libraries from two human mammary cell lines expressing basal (HB4a) and high (C5.2) levels of ERBB2 before and after intensive exposure to docetaxel and identified potential ERBB2 target genes implicated in a variety of cellular processes including cell proliferation, cell adhesion, apoptosis and cytoskeleton organization. Comparison of the transcriptome of the cell lines before and after docetaxel exposure revealed substantially different expression patterns. Twenty-one differentially expressed genes between HB4a and C5.2 cell lines, before and after docetaxel treatment, were further analyzed by qPCR. The alterations in the expression patterns in HB4a and C5.2 cell lines in response to docetaxel treatment observed by SAGE analysis were confirmed by qPCR for the majority of the genes analyzed. Our study provides a comprehensive view of the expression changes induced in two human mammary cells expressing different levels of ERBB2 in response to docetaxel that could contribute to the elucidation of the mechanisms involved in ERBB2-mediated chemoresistance in breast cancer.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In a previous study, we found that the cytokine (human) leukemia inhibitory factor (hLIF) significantly reduced plasma cholesterol levels and the accumulation of lipid in aortic tissues of cholesterol-fed rabbits after 4 weeks of treatment. The mechanisms by which this occurs were investigated in the present study. This involved examining the effect of hLIF on (1) the level of plasma cholesterol at different times throughout the 4-week treatment and diet period; (2) smooth muscle cell (SMC) and macrophage-derived foam cell formation in vitro; and (3) LDL receptor expression and uptake in the human hepatoma cell line HepG2. At time zero, an osmotic minipump (2-mL capacity; infusion rate, 2.5 mu L/h; 28 days) containing either hLIF (30 mu g.kg(-1).d(-1)) or saline was inserted into the peritoneal cavity of New Zealand White rabbits (N=24). Rabbits were divided into four groups of six animals each. Group 1 received a normal diet/saline; group 2, a normal diet/hLIF; group 3, a 1% cholesterol diet/saline; and group 4, a 1% cholesterol diet/hLIF. hLIF had no effect on the plasma lipids or artery wall of group 2 rabbits (normal diet). However, in group 4 rabbits, plasma cholesterol levels and the percent surface area of thoracic aorta covered by fatty streaks was decreased by approximate to 30% and 80%, respectively, throughout all stages of the 4-week treatment period. In vitro, hLIF failed to prevent lipoprotein uptake by either SMCs or macrophages (foam cell formation) when the cells were exposed to P-VLDL for 24 hours. In contrast, hLIF (100 ng/mL) added to cultured human hepatoma HepG2 cells induced a twofold or threefold increase in intracellular lipid accumulation in the medium containing 10% lipoprotein-deficient serum or 10% fetal calf serum, respectively. This was accompanied by a significant non-dose-dependent increase in LDL receptor expression in hLIF-treated HepG2 cells incubated with LDL (20 mu g/mL) when compared with controls (P

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Superparamagnetic iron oxide nanoparticles (SPIONs) are applied in stem cell labeling because of their high magnetic susceptibility as compared with ordinary paramagnetic species, their low toxicity, and their ease of magnetic manipulation. The present work is the study of CD133(+) stem cell labeling by SPIONs coupled to a specific antibody (AC133), resulting in the antigenic labeling of the CD133+ stem cell, and a method was developed for the quantification of the SPION content per cell, necessary for molecular imaging optimization. Flow cytometry analysis established the efficiency of the selection process and helped determine that the CD133 cells selected by chromatographic affinity express the transmembrane glycoprotein CD133. The presence of antibodies coupled to the SPION, expressed in the cell membrane, was observed by transmission electron microscopy. Quantification of the SPION concentration in the marked cells using the ferromagnetic resonance technique resulted in a value of 1.70 x 10 (13) mol iron (9.5 pg) or 7.0 x 10 (6) nanoparticles per cell ( the measurement was carried out in a volume of 2 mu L containing about 6.16 x 10 5 pg iron, equivalent to 4.5 x 10 (11) SPIONs). (c) 2008 Elsevier Inc. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objectives: To examine the effects of triiodothyronine (T(3)), 17 beta-estradiol (E(2)), and tamoxifen (TAM) on transforming growth factor (TGF)-alpha gene expression in primary breast cancer cell cultures and interactions between the different treatments. Methods and results: Patients included in the study (no.=12) had been newly diagnosed with breast cancer. Fresh human breast carcinoma tissue was cut into 0.3-mm slices. These slices were placed in six 35-mm dishes on 2-ml organ culture medium. Dishes received the following treatments: dish 1: ethanol; dish 2: T(3); dish 3: T(3)+TAM; dish 4: TAM; dish 5: E(2); dish 6: E(2)+TAM. TGF-alpha mRNA content was normalized to glyceraldehyde-3-phosphate dehydrogenase mRNA levels. All tissues included in this study were positive for estrogen receptor (ER) and thyroid hormone receptor expression. Treatment with T(3) for 48 h significantly increased TGF-alpha mRNA levels compared to controls (15-fold), and concomitant treatment with TAM reduced expression to 3.4-fold compared to controls. When only TAM was added to the culture medium, TGF-alpha mRNA expression increased 5.3-fold, significantly higher than with all other treatment modalities. Conclusion: We demonstrate that TGF-alpha mRNA expression is more efficiently upregulated by T(3) than E(2). Concomitant treatment with TAM had a mitigating effect on the T(3) effect, while E(2) induced TGF-alpha upregulation. Our findings show some similarities between primary culture and breast cancer cell lines, but also some important differences: a) induction of TGF-alpha, a mitogenic protein, by TAM; b) a differential effect of TAM that may depend on relative expression of ER alpha and beta; and c) supraphysiological doses of T3 may induce mitogenic signals in breast cancer tissue under conditions of low circulating E(2).. Endocrinol. Invest. 31: 1047-1051, 2008) (c) 2008, Editrice Kurtis