987 resultados para Brown, Matthew P


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The storage and processing capacity realised by computing has lead to an explosion of data retention. We now reach the point of information overload and must begin to use computers to process more complex information. In particular, the proposition of the Semantic Web has given structure to this problem, but has yet realised practically. The largest of its problems is that of ontology construction; without a suitable automatic method most will have to be encoded by hand. In this paper we discus the current methods for semi and fully automatic construction and their current shortcomings. In particular we pay attention the application of ontologies to products and the particle application of the ontologies.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Four foliar and two stem-base pathogens were inoculated onto wheat plants grown in different substrates in pot experiments. Soils from four different UK locations were each treated in three ways: (i) straw incorporated in the field at 10 t ha−1 several months previously; (ii) silicon fertilization at 100 mg L−1 during the experiment; and (iii) no amendments. A sand and vermiculite mix was used with and without silicon amendment. The silicon treatment increased plant silica concentrations in all experiments, but incorporating straw was not associated with raised plant silica concentrations. Blumeria graminis and Puccinia recondita were inoculated by shaking infected plants over the test plants, followed by suitable humid periods. The silicon treatment reduced powdery mildew (B. graminis) substantially in sand and vermiculite and in two of the soils, but there were no effects on the slight infection by brown rust (P. recondita). Phaeosphaeria nodorum and Mycosphaerella graminicola were inoculated as conidial suspensions. Leaf spot caused by P. nodorum was reduced in silicon-amended sand and vermiculite; soil was not tested. Symptoms of septoria leaf blotch caused by M. graminicola were reduced by silicon amendment in a severely infected sand and vermiculite experiment but not in soil or a slightly infected sand and vermiculite experiment. Oculimacula yallundae (eyespot) and Fusarium culmorum (brown foot rot) were inoculated as agar plugs on the stem base. Severity of O. yallundae was reduced by silicon amendment of two of the soils but not sand and vermiculite; brown foot rot symptoms caused by F. culmorum were unaffected by silicon amendment. The straw treatment reduced severity of powdery mildew but did not detectably affect the other pathogens. Both straw and silicon treatments appeared to increase plant resistance to all diseases only under high disease pressure.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Objective: The construct of 'clinical perfectionism' has been developed in response to criticisms that other approaches have failed to yield advances in the treatment of the type of self-oriented perfectionism that poses a clinical problem. The primary aim of this study was to conduct a preliminary investigation into the efficacy of a theory-driven, cognitive-behavioural intervention for 'clinical perfectionism'. Design. A multiple baseline single case series design was used. Method: A specific, 10-session cognitive-behavioural intervention to address clinical perfectionism in eating disorders was adapted to allow its use in nine patients referred with a range of axis I disorders and clinical perfectionism. Results: The intervention led to clinically significant improvements in self-referential perfectionism from pretreatment to follow-up for six of the nine participants on two perfectionism measures and for three of the nine participants on the measure of clinical perfectionism. Statistically significant improvements from pre- to post-intervention for the group as a whole were found on all three measures. The improvements were maintained at follow-up. Conclusions: The finding that clinical perfectionism is improved in the majority of participants is particularly encouraging given that perfectionism has traditionally been viewed as a personality characteristic resistant to change. These preliminary findings warrant replication in a larger study.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

There has been recent interest in sensory systems that are able to display a response which is proportional to a fold change in stimulus concentration, a feature referred to as fold-change detection (FCD). Here, we demonstrate FCD in a recent whole-pathway mathematical model of Escherichia coli chemotaxis. FCD is shown to hold for each protein in the signalling cascade and to be robust to kinetic rate and protein concentration variation. Using a sensitivity analysis, we find that only variations in the number of receptors within a signalling team lead to the model not exhibiting FCD. We also discuss the ability of a cell with multiple receptor types to display FCD and explain how a particular receptor configuration may be used to elucidate the two experimentally determined regimes of FCD behaviour. All findings are discussed in respect of the experimental literature.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Tropical Applications of Meteorology Using Satellite and Ground-Based Observations (TAMSAT) rainfall estimates are used extensively across Africa for operational rainfall monitoring and food security applications; thus, regional evaluations of TAMSAT are essential to ensure its reliability. This study assesses the performance of TAMSAT rainfall estimates, along with the African Rainfall Climatology (ARC), version 2; the Tropical Rainfall Measuring Mission (TRMM) 3B42 product; and the Climate Prediction Center morphing technique (CMORPH), against a dense rain gauge network over a mountainous region of Ethiopia. Overall, TAMSAT exhibits good skill in detecting rainy events but underestimates rainfall amount, while ARC underestimates both rainfall amount and rainy event frequency. Meanwhile, TRMM consistently performs best in detecting rainy events and capturing the mean rainfall and seasonal variability, while CMORPH tends to overdetect rainy events. Moreover, the mean difference in daily rainfall between the products and rain gauges shows increasing underestimation with increasing elevation. However, the distribution in satellite–gauge differences demon- strates that although 75% of retrievals underestimate rainfall, up to 25% overestimate rainfall over all eleva- tions. Case studies using high-resolution simulations suggest underestimation in the satellite algorithms is likely due to shallow convection with warm cloud-top temperatures in addition to beam-filling effects in microwave- based retrievals from localized convective cells. The overestimation by IR-based algorithms is attributed to nonraining cirrus with cold cloud-top temperatures. These results stress the importance of understanding re- gional precipitation systems causing uncertainties in satellite rainfall estimates with a view toward using this knowledge to improve rainfall algorithms.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

We formulate an agent-based population model of Escherichia coli cells which incorporates a description of the chemotaxis signalling cascade at the single cell scale. The model is used to gain insight into the link between the signalling cascade dynamics and the overall population response to differing chemoattractant gradients. Firstly, we consider how the observed variation in total (phosphorylated and unphosphorylated) signalling protein concentration affects the ability of cells to accumulate in differing chemoattractant gradients. Results reveal that a variation in total cell protein concentration between cells may be a mechanism for the survival of cell colonies across a wide range of differing environments. We then study the response of cells in the presence of two different chemoattractants.In doing so we demonstrate that the population scale response depends not on the absolute concentration of each chemoattractant but on the sensitivity of the chemoreceptors to their respective concentrations. Our results show the clear link between single cell features and the overall environment in which cells reside.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Remotely sensed rainfall is increasingly being used to manage climate-related risk in gauge sparse regions. Applications based on such data must make maximal use of the skill of the methodology in order to avoid doing harm by providing misleading information. This is especially challenging in regions, such as Africa, which lack gauge data for validation. In this study, we show how calibrated ensembles of equally likely rainfall can be used to infer uncertainty in remotely sensed rainfall estimates, and subsequently in assessment of drought. We illustrate the methodology through a case study of weather index insurance (WII) in Zambia. Unlike traditional insurance, which compensates proven agricultural losses, WII pays out in the event that a weather index is breached. As remotely sensed rainfall is used to extend WII schemes to large numbers of farmers, it is crucial to ensure that the indices being insured are skillful representations of local environmental conditions. In our study we drive a land surface model with rainfall ensembles, in order to demonstrate how aggregation of rainfall estimates in space and time results in a clearer link with soil moisture, and hence a truer representation of agricultural drought. Although our study focuses on agricultural insurance, the methodological principles for application design are widely applicable in Africa and elsewhere.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Modern medical imaging techniques enable the acquisition of in vivo high resolution images of the vascular system. Most common methods for the detection of vessels in these images, such as multiscale Hessian-based operators and matched filters, rely on the assumption that at each voxel there is a single cylinder. Such an assumption is clearly violated at the multitude of branching points that are easily observed in all, but the Most focused vascular image studies. In this paper, we propose a novel method for detecting vessels in medical images that relaxes this single cylinder assumption. We directly exploit local neighborhood intensities and extract characteristics of the local intensity profile (in a spherical polar coordinate system) which we term as the polar neighborhood intensity profile. We present a new method to capture the common properties shared by polar neighborhood intensity profiles for all the types of vascular points belonging to the vascular system. The new method enables us to detect vessels even near complex extreme points, including branching points. Our method demonstrates improved performance over standard methods on both 2D synthetic images and 3D animal and clinical vascular images, particularly close to vessel branching regions. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The imprints of domestication and breed development on the genomes of livestock likely differ from those of companion animals. A deep draft sequence assembly of shotgun reads from a single Hereford female and comparative sequences sampled from six additional breeds were used to develop probes to interrogate 37,470 single-nucleotide polymorphisms (SNPs) in 497 cattle from 19 geographically and biologically diverse breeds. These data show that cattle have undergone a rapid recent decrease in effective population size from a very large ancestral population, possibly due to bottlenecks associated with domestication, selection, and breed formation. Domestication and artificial selection appear to have left detectable signatures of selection within the cattle genome, yet the current levels of diversity within breeds are at least as great as exists within humans.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

As the methodologies available for the detection of positive selection from genomic data vary in terms of assumptions and execution, weak correlations are expected among them. However, if there is any given signal that is consistently supported across different methodologies, it is strong evidence that the locus has been under past selection. In this paper, a straightforward frequentist approach based on the Stouffer Method to combine P-values across different tests for evidence of recent positive selection in common variations, as well as strategies for extracting biological information from the detected signals, were described and applied to high density single nucleotide polymorphism (SNP) data generated from dairy and beef cattle (taurine and indicine). The ancestral Bovinae allele state of over 440,000 SNP is also reported. Using this combination of methods, highly significant (P<3.17×10-7) population-specific sweeps pointing out to candidate genes and pathways that may be involved in beef and dairy production were identified. The most significant signal was found in the Cornichon homolog 3 gene (CNIH3) in Brown Swiss (P = 3.82×10-12), and may be involved in the regulation of pre-ovulatory luteinizing hormone surge. Other putative pathways under selection are the glucolysis/gluconeogenesis, transcription machinery and chemokine/cytokine activity in Angus; calpain-calpastatin system and ribosome biogenesis in Brown Swiss; and gangliosides deposition in milk fat globules in Gyr. The composite method, combined with the strategies applied to retrieve functional information, may be a useful tool for surveying genome-wide selective sweeps and providing insights in to the source of selection.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Although Recovery is often defined as the less studied and documented phase of the Emergency Management Cycle, a wide literature is available for describing characteristics and sub-phases of this process. Previous works do not allow to gain an overall perspective because of a lack of systematic consistent monitoring of recovery utilizing advanced technologies such as remote sensing and GIS technologies. Taking into consideration the key role of Remote Sensing in Response and Damage Assessment, this thesis is aimed to verify the appropriateness of such advanced monitoring techniques to detect recovery advancements over time, with close attention to the main characteristics of the study event: Hurricane Katrina storm surge. Based on multi-source, multi-sensor and multi-temporal data, the post-Katrina recovery was analysed using both a qualitative and a quantitative approach. The first phase was dedicated to the investigation of the relation between urban types, damage and recovery state, referring to geographical and technological parameters. Damage and recovery scales were proposed to review critical observations on remarkable surge- induced effects on various typologies of structures, analyzed at a per-building level. This wide-ranging investigation allowed a new understanding of the distinctive features of the recovery process. A quantitative analysis was employed to develop methodological procedures suited to recognize and monitor distribution, timing and characteristics of recovery activities in the study area. Promising results, gained by applying supervised classification algorithms to detect localization and distribution of blue tarp, have proved that this methodology may help the analyst in the detection and monitoring of recovery activities in areas that have been affected by medium damage. The study found that Mahalanobis Distance was the classifier which provided the most accurate results, in localising blue roofs with 93.7% of blue roof classified correctly and a producer accuracy of 70%. It was seen to be the classifier least sensitive to spectral signature alteration. The application of the dissimilarity textural classification to satellite imagery has demonstrated the suitability of this technique for the detection of debris distribution and for the monitoring of demolition and reconstruction activities in the study area. Linking these geographically extensive techniques with expert per-building interpretation of advanced-technology ground surveys provides a multi-faceted view of the physical recovery process. Remote sensing and GIS technologies combined to advanced ground survey approach provides extremely valuable capability in Recovery activities monitoring and may constitute a technical basis to lead aid organization and local government in the Recovery management.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Little is known about the temporal impact of the rapid scale-up of large antiretroviral therapy (ART) services on programme outcomes. We describe patient outcomes [mortality, loss-to-follow-up (LTFU) and retention] over time in a network of South African ART cohorts.