599 resultados para Antisense Oligodeoxynucleotides


Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: Cellular processes underlying memory formation are evolutionary conserved, but natural variation in memory dynamics between animal species or populations is common. The genetic basis of this fascinating phenomenon is poorly understood. Closely related species of Nasonia parasitic wasps differ in long-term memory (LTM) formation: N. vitripennis will form transcription-dependent LTM after a single conditioning trial, whereas the closely-related species N. giraulti will not. Genes that were differentially expressed (DE) after conditioning in N. vitripennis, but not in N. giraulti, were identified as candidate genes that may regulate LTM formation. RESULTS: RNA was collected from heads of both species before and immediately, 4 or 24 hours after conditioning, with 3 replicates per time point. It was sequenced strand-specifically, which allows distinguishing sense from antisense transcripts and improves the quality of expression analyses. We determined conditioning-induced DE compared to naïve controls for both species. These expression patterns were then analysed with GO enrichment analyses for each species and time point, which demonstrated an enrichment of signalling-related genes immediately after conditioning in N. vitripennis only. Analyses of known LTM genes and genes with an opposing expression pattern between the two species revealed additional candidate genes for the difference in LTM formation. These include genes from various signalling cascades, including several members of the Ras and PI3 kinase signalling pathways, and glutamate receptors. Interestingly, several other known LTM genes were exclusively differentially expressed in N. giraulti, which may indicate an LTM-inhibitory mechanism. Among the DE transcripts were also antisense transcripts. Furthermore, antisense transcripts aligning to a number of known memory genes were detected, which may have a role in regulating these genes. CONCLUSION: This study is the first to describe and compare expression patterns of both protein-coding and antisense transcripts, at different time points after conditioning, of two closely related animal species that differ in LTM formation. Several candidate genes that may regulate differences in LTM have been identified. This transcriptome analysis is a valuable resource for future in-depth studies to elucidate the role of candidate genes and antisense transcription in natural variation in LTM formation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatory therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Obesity development during psychotropic treatments represents a major health issue in psychiatry. Melanin-concentrating hormone receptor 2 (MCHR2) is a central receptor involved in energy homeostasis. MCHR2 shares its promoter region with MCHR2-AS1, a long antisense non-coding RNA. The aim of this study was to determine whether tagging single nucleotide polymorphisms (tSNPs) of MCHR2 and MCHR2-AS1 are associated with the body mass index (BMI) in the psychiatric and in the general population. The influence of MCHR2 and MCHR2-AS1 tSNPs on BMI was firstly investigated in a discovery psychiatric sample (n1 = 474). Positive results were tested for replication in two other psychiatric samples (n2 = 164, n3 = 178) and in two population-based samples (CoLaus, n4 = 5409; GIANT, n5 = 113809). In the discovery sample, TT carriers of rs7754794C>T had 1.08 kg/m2 (p = 0.04) lower BMI as compared to C-allele carriers. This observation was replicated in an independent psychiatric sample (-2.18 kg/m2; p = 0.009). The association of rs7754794C>T and BMI seemed stronger in subjects younger than 45 years (median of age). In the population-based sample, a moderate association was observed (-0.17 kg/m2; p = 0.02) among younger individuals (<45y). Interestingly, this association was totally driven by patients meeting lifetime criteria for atypical depression, i.e. major depressive episodes characterized by symptoms such as an increased appetite. Indeed, patients with atypical depression carrying rs7754794-TT had 1.17 kg/m2 (p = 0.04) lower BMI values as compared to C-allele carriers, the effect being stronger in younger individuals (-2.50 kg/m2; p = 0.03; interaction between rs7754794 and age: p-value = 0.08). This study provides new insights on the possible influence of MCHR2 and/or MCHR2-AS1 on obesity in psychiatric patients and on the pathophysiology of atypical depression.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

One old dream of the chemist in the field of the drug research is to create molecules capable of reaching their target with the precision of a missile. To accomplish it these molecules must have the propriety of distinguishing qualitative differences between healthy and diseased cells. A therapy based on this principle, able of eradicating specifically defective cells, or cells affected by a pathogen has an enormous advantage with the regard to the classical approach in which the cytotoxic drugs merely exploit quantitative biochemical and kinetic differences between abnormal and normal cells. We present in this article a review on the chemical synthesis of analogues of desoxyribonucleotides and on results obtained on the specific and irreversible inhibition of undesired genetic expression using the antisense principle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A large number of DNA sequences corresponding to human and animal transcripts have been filed in data banks, as cDNAs or ESTs (expression sequence tags). However, the actual function of their corresponding gene products is still largely unknown. Several of these genes may play a role in regulation of important biological processes such as cell division, differentiation, malignant transformation and oncogenesis. Elucidation of gene function is based on 2 main approaches, namely, overexpression and expression interference, which respectively mimick or suppress a given phenotype. The currently available tools and experimental approaches to gene functional analysis and the most recent advances in mass cDNA screening by functional analysis are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Water channels or aquaporins (AQPs) have been identified in a large variety of tissues. Nevertheless, their role in the human gastrointestinal tract, where their action is essential for the reabsorption and secretion of water and electrolytes, is still unclear. The purpose of the present study was to investigate the structure and function of water channels expressed in the human colon. A cDNA fragment of about 420 bp with a 98% identity to human AQP3 was amplified from human stomach, small intestine and colon by reverse transcription polymerase chain reaction (RT-PCR) and a transcript of 2.2 kb was expressed more abundantly in colon than in jejunum, ileum and stomach as indicated by Northern blots. Expression of mRNA from the colon of adults and children but not from other gastrointestinal regions in Xenopus oocytes enhanced the osmotic water permeability, and the urea and glycerol transport in a manner sensitive to an antisense AQP3 oligonucleotide, indicating the presence of functional AQP3. Immunocytochemistry and immunofluorescence studies in human colon revealed that the AQP3 protein is restricted to the villus epithelial cells. The immunostaining within these cells was more intense in the apical than in the basolateral membranes. The presence of AQP3 in villus epithelial cells suggests that AQP3 is implicated in water absorption across human colonic surface cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In addition to the mutations that underlie most cases of the multiple endocrine neoplasia type 1 (MEN1) syndrome, somatic mutations of the MEN1 gene have also been described in sporadic tumors like gastrinomas, insulinomas and bronchial carcinoid neoplasm. We examined exon 2 of this gene, where most of the mutations have been described, in 148 endocrine and nonendocrine sporadic tumors. DNA was obtained by phenol/chloroform extraction and ethanol precipitation from 92 formalin-fixed, paraffin-embedded samples, and from 40 fresh tumor tissue samples. We used 5 pairs of primers to encompass the complete coding sequence of exon 2 of the MEN1 gene that was screened by the polymerase chain reaction-single-stranded conformation polymorphism (PCR-SSCP) technique in 78 sporadic thyroid cancers: 28 follicular adenomas, 35 papillary carcinomas, 14 follicular carcinomas, and 1 anaplastic thyroid carcinoma. We also examined 46 adrenal lesions (3 hyperplasias, 3 adenomas and 35 adrenocortical carcinomas, 2 pheochromocytomas, 2 ganglioneuroblastomas, and 1 lymphoma) and 24 breast cancers (6 noninvasive, 16 infiltrating ductal, and 2 invasive lobular tumors). The PCR product of 5 tumors suspected to present band shifts by SSCP was cloned. Direct sense and antisense sequencing did not identify mutations. These results suggest that the MEN1 gene is not important in breast, thyroid or adrenal sporadic tumorigenesis. Because the frequency of mutations varies significantly among tumor subgroups and allelic deletions are frequently observed at 11q13 in thyroid and adrenal cancers, another tumor suppressor gene residing in this region is likely to be involved in the tumorigenesis of these neoplasms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oligonucleotides have a wide range of applications in fields such as biotechnology, molecular biology, diagnosis and therapy. However, the spectrum of uses can be broadened by introducing chemical modifications into their structures. The most prolific field in the search for new oligonucleotide analogs is the antisense strategy, where chemical modifications confer appropriate characteristics such as hybridization, resistance to nucleases, cellular uptake, selectivity and, basically, good pharmacokinetic and pharmacodynamic properties. Combinatorial technology is another research area where oligonucleotides and their analogs are extensively employed. Aptamers, new catalytic ribozymes and deoxyribozymes are RNA or DNA molecules individualized from a randomly synthesized library on the basis of a particular property. They are identified by repeated cycles of selection and amplification, using PCR technologies. Modified nucleotides can be introduced either during the amplification procedure or after selection.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The establishment of dorsal-ventral polarity in Drosophila is a complex process which involves the action of maternal and zygotically expressed genes. Interspecific differences in the expression pattern of some of these genes have been described in other species. Here we present the expression of dorsal-ventral genes during early embryogenesis in the lower dipteran Rhynchosciara americana. The expression of four genes, the ventralizing genes snail (sna) and twist (twi) and the dorsalizing genes decapentaplegic (dpp) and zerknüllt (zen), was investigated by whole-mount in situ hybridization. Sense and antisense mRNA were transcribed in vitro using UTP-digoxigenin and hybridized at 55°C with dechorionated fixed embryos. Staining was obtained with anti-digoxigenin alkaline phosphatase-conjugated antibody revealed with NBT-BCIP solution. The results showed that, in general, the spatial-temporal expression of R. americana dorsal-ventral genes is similar to that observed in Drosophila, where twi and sna are restricted to the ventral region, while dpp and zen are expressed in the dorsal side. The differences encountered were subtle and probably represent a particular aspect of dorsal-ventral axis determination in R. americana. In this lower dipteran sna is expressed slightly later than twi and dpp expression is expanded over the lateral ectoderm during cellular blastoderm stage. These data suggest that the establishment of dorsal-ventral polarity in R. americana embryos follows a program similar to that observed in Drosophila melanogaster.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

TP53, a tumor suppressor gene, has a critical role in cell cycle, apoptosis and cell senescence and participates in many crucial physiological and pathological processes. Identification of TP53 polymorphism in older people and age-related diseases may provide an understanding of its physiology and pathophysiological role as well as risk factors for complex diseases. TP53 codon 72 (TP53:72) polymorphism was investigated in 383 individuals aged 66 to 97 years in a cohort from a Brazilian Elderly Longitudinal Study. We investigated allele frequency, genotype distribution and allele association with morbidities such as cardiovascular disease, type II diabetes, obesity, neoplasia, low cognitive level (dementia), and depression. We also determined the association of this polymorphism with serum lipid fractions and urea, creatinine, albumin, fasting glucose, and glycated hemoglobin levels. DNA was isolated from blood cells, amplified by PCR using sense 5'-TTGCCGTCCCAAGCAATGGATGA-3' and antisense 5'-TCTGGGAAGGGACAGAAGATGAC-3' primers and digested with the BstUI enzyme. This polymorphism is within exon 4 at nucleotide residue 347. Descriptive statistics, logistic regression analysis and Student t-test using the multiple comparison test were used. Allele frequencies, R (Arg) = 0.69 and P (Pro) = 0.31, were similar to other populations. Genotype distributions were within Hardy-Weinberg equilibrium. This polymorphism did not show significant association with any age-related disease or serum variables. However, R allele carriers showed lower HDL levels and a higher frequency of cardiovascular disease than P allele subjects. These findings may help to elucidate the physiopathological role of TP53:72 polymorphism in Brazilian elderly people.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Small cell lung cancer (SCLC) is an aggressive disease, representing 15% of all cases of lung cancer, has high metastatic potential and low prognosis that urgently demands the development of novel therapeutic approaches. One of the proposed approaches has been the down-regulation of BCL2, with poorly clarified and controversial therapeutic value regarding SCLC. The use of anti-BCL2 small interfering RNA (siRNA) in SCLC has never been reported. The aim of the present study was to select and test the in vitro efficacy of anti-BCL2 siRNA sequences against the protein and mRNA levels of SCLC cells, and their effects on cytotoxicity and chemosensitization. Two anti-BCL2 siRNAs and the anti-BCL2 G3139 oligodeoxynucleotide (ODN) were evaluated in SCLC cells by the simultaneous determination of Bcl-2 and viability using a flow cytometry method recently developed by us in addition to Western blot, real-time reverse-transcription PCR, and cell growth after single and combined treatment with cisplatin. In contrast to previous reports about the use of ODN, a heterogeneous and up to 80% sequence-specific Bcl-2 protein knockdown was observed in the SW2, H2171 and H69 SCLC cell lines, although without significant sequence-specific reduction of cell viability, cell growth, or sensitization to cisplatin. Our results question previous data generated with antisense ODN and supporting the present concept of the therapeutic interest in BCL2 silencing per se in SCLC, and support the growing notion of the necessity of a multitargeting molecular approach for the treatment of cancer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In the last decades, the chemical synthesis of short oligonucleotides has become an important aspect of study due to the discovery of new functions for nucleic acids such as antisense oligonucleotides (ASOs), aptamers, DNAzymes, microRNA (miRNA) and small interfering RNA (siRNA). The applications in modern therapies and fundamental medicine on the treatment of different cancer diseases, viral infections and genetic disorders has established the necessity to develop scalable methods for their cheaper and easier industrial manufacture. While small scale solid-phase oligonucleotide synthesis is the method of choice in the field, various challenges still remain associated with the production of short DNA and RNA-oligomers in very large quantities. On the other hand, solution phase synthesis of oligonucleotides offers a more predictable scaling-up of the synthesis and is amenable to standard industrial manufacture techniques. In the present thesis, various protocols for the synthesis of short DNA and RNA oligomers have been studied on a peracetylated and methylated β-cyclodextrin, and also on a pentaerythritol-derived support. On using the peracetylated and methylated β-cyclodextrin soluble supports, the coupling cycle was simplified by replacement of the typical 5′-O-(4,4′-dimethoxytrityl) protecting group with an acid-labile acetal-protected 5′-O-(1-methoxy-1-methylethyl) group, which upon acid-catalyzed methanolysis released easily removable volatile products. For this reason monomeric building blocks 5′-O-(1-methoxy-1-methylethyl) 3′-(2-cyano-ethyl-N,N-diisopropylphosphoramidite) were synthesized. Alternatively, on using the precipitative pentaerythritol support, novel 2´-O-(2-cyanoethyl)-5´-O-(1-methoxy-1-methylethyl) protected phosphoramidite building blocks for RNA synthesis have been prepared and their applicability by the synthesis of a pentamer was demonstrated. Similarly, a method for the preparation of short RNAs from commercially available 5´-O-(4,4´-dimethoxytrityl)-2´-O-(tert-butyldimethyl-silyl)ribonucleoside 3´-(2-cyanoethyl-N,N-diisopropylphosphoramidite) building blocks has been developed

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Gene therapy is predicated upon efficient gene transfer. While viral vectors are the method of choice for transformation efficiency, the immunogenicity and safety concerns remain problematic. Non-viral vectors, on the other hand, have shown high degrees of safety and are mostly non-immunogenic in nature. However, non-viral vectors usually suffer from low levels oftransformation efficiency and transgene expression. Thus, increasing transformation efficiency ofnon-viral vectors, in particular by calcium phosphate co-precipitation technique, is a way of generating a suitable vector for gene therapy and is the aim of this study. It is a long known fact that different cell lines have different transfection efficiencies regardless oftransfection methodology (Lin et a!., 1994). Using commonly available cell lines Madine-Darby Bovine Kidney (MDBK), HeLa and Human Embryonic Kidney (HEK-293), we have shown a decreasing trend ofDNase activity based on a plasmid digestion assay. From densitometry studies, as much as a 40% reduction in DNase activity was observed when comparing HEK-293 (least active) to MDBK (most active). Using various biochemical assays, it was determined that DNase y, in particular, was expressed more highly in MDBK cells than both HeLa and HEK-293. Upon cloning of the bovine DNase y gene, we utilized the sequence information to construct antisense expressing plasmids via both traditional antisense RNA (pASDGneoM) and siRNA (psiRNA-S4, psiRNA-S11 and psiRNA-S16). For the construction ofpASDGneoM, the 3' end of the DNase y was inserted in opposite orientation under a cytomegalovirus (CMV) promoter such that the expression ofRNA complementary to the DNase 2 ymRNA occurred. For siRNA plasmids, the sequence was screened to yield optimal short sequences for siRNA inhibition. The silencing ofbovine DNase y led to an increase in transfection efficiency based on traditional calcium phosphate co-precipitation technique; stable clones of siRNA-producing MDBK cell lines (psiRNA-S4 Bland psiRNA-S4 B4) both demol).strated 4-fold increases in transfection efficiency. Furthermore, serial transfection of antisense DNase y plasmid pASDGneoM and reporter pCMV-~ showed a maximum of 8-fold increase in transfection efficiency when the two separate transfections were carried out 4 hours apart (i.e. transfection ofpASDGneoM, separated by four hours, then transfection ofpCMV-~). Together, these results demonstrate the involvement ofDNase y in reducing transfection efficiency, at least by traditional calcium phosphate technique.