Molecular interactions between the penetration enhancer 1,8-cineole and human skin

Penetration enhancers are chemicals that temporarily and reversibly diminish the barrier function of the outermost layer of skin, the stratum corneum, to facilitate drug delivery to and through the tissue. In the current study, the complex mechanisms by which 1,8-cineole, a potent terpene penetration enhancer, disrupts the stratum corneum barrier is investigated using post-mortem skin samples. In order to validate the use of excised tissue for these and related studies, a fibre optical probe coupled to an FT-Raman spectrometer compared spectroscopic information for human skin recorded from in vivo and in vitro sampling arrangements. Spectra from full-thickness (epidermis and dermis) post-mortem skin samples presented to the spectrometer with minimal sample preparation (cold acetone rinse) were compared with the in vivo system (the forearms of human volunteers). No significant differences in the Raman spectra between the in vivo and in vitro samples were observed, endorsing the use of post-mortem or surgical samples for this investigational work. Treating post-mortem samples with the penetration enhancer revealed some unexpected findings: while evidence for enhancer-induced disruption of the barrier lipid packing in the stratum corneum was detected in some samples, spectra from other samples revealed an increase in lipid order on treatment with the permeation promoter. These findings are consistent with phase-separation of the enhancer within the barrier lipid domains as opposed to homogeneous disruption of the lipid lamellae. Copyright (C) 2006 John Wiley & Sons, Ltd.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Investigation of liquid MALDI and optimization for instrument tuning and quantitative measurements

The success of Matrix-assisted laser desorption / ionisation (MALDI) in fields such as proteomics has partially but not exclusively been due to the development of improved data acquisition and sample preparation techniques. This has been required to overcome some of the short comings of the commonly used solid-state MALDI matrices such as - cyano-4-hydroxycinnamic acid (CHCA) and 2,5-dihydroxybenzoic acid (DHB). Solid state matrices form crystalline samples with highly inhomogeneous topography and morphology which results in large fluctuations in analyte signal intensity from spot to spot and positions within the spot. This means that efficient tuning of the mass spectrometer can be impeded and the use of MALDI MS for quantitative measurements is severely impeded. Recently new MALDI liquid matrices have been introduced which promise to be an effective alternative to crystalline matrices. Generally the liquid matrices comprise either ionic liquid matrices (ILMs) or a usually viscous liquid matrix which is doped with a UV lightabsorbing chromophore [1-3]. The advantages are that the droplet surface is smooth and relatively uniform with the analyte homogeneously distributed within. They have the ability to replenish a sampling position between shots negating the need to search for sample hot-spots. Also the liquid nature of the matrix allows for the use of additional additives to change the environment to which the analyte is added.

Self-assembly and hydrogelation of an amyloid peptide fragment

The self-assembly of a fragment of the amyloid beta peptide that has been shown to be critical in amyloid fibrillization has been studied in aqueous solution. There are conflicting reports in the literature on the fibrillization of A beta (16-20), i.e., KLVFF, and our results shed light on this. In dilute solution, self-assembly of NH2-KLVFF-COOH is strongly influenced by aromatic interactions between phenylalanine units, as revealed by UV spectroscopy and circular dichroism. Fourier transform infrared (FTIR) spectroscopy reveals beta-sheet features in spectra taken for more concentrated solutions and also dried films. X-ray diffraction and cryo-transmission electron microscopy (cryo-TEM) provide further support for beta-sheet amyloid fibril formation. A comparison of cryo-TEM images with those from conventional dried and negatively stained TEM specimens highlights the pronounced effects of sample preparation on the morphology. A comparison of FTIR data for samples in solution and dried samples also highlights the strong effect of drying on the self-assembled structure. In more concentrated phosphate-buffered saline (PBS) solution, gelation of NH2-KLVFF-COOH is observed. This is believed to be caused by screening of the electrostatic charge on the peptide, which enables beta sheets to aggregate into a fibrillar gel network. The rheology of the hydrogel is probed, and the structure is investigated by light scattering and small-angle X-ray scattering.

Recommendations for the viability assessment of probiotics as concentrated cultures and in food matrices

Due to the fact that probiotic cells need to be alive when they are consumed, culture-based analysis (plate count) is critical in ascertaining the quality (numbers of viable cells) of probiotic products. Since probiotic cells are typically stressed, due to various factors related to their production, processing and formulation, the standard methodology for total plate counts tends to underestimate the cell numbers of these products. Furthermore, products such as microencapsulated cultures require modifications in the release and sampling procedure in order to correctly estimate viable counts. This review examines the enumeration of probiotic bacteria in the following commercial products: powders, microencapsulated cultures, frozen concentrates, capsules, foods and beverages. The parameters which are specifically examined include: sample preparation (rehydration, thawing), dilutions (homogenization, media) and plating (media, incubation) procedures. Recommendations are provided for each of these analytical steps to improve the accuracy of the analysis. Although the recommendations specifically target the analysis of probiotics, many will apply to the analysis of commercial lactic starter cultures used in food fermentations as well.

Structurally-related (−)-epicatechin metabolites in humans: assessment using de novo chemically synthesized authentic standards

Accumulating data suggest that diets rich in flavanols and procyanidins are beneficial for human health. In this context, there has been a great interest in elucidating the systemic levels and metabolic profiles at which these compounds occur in humans. While recent progress has been made, there still exist considerable differences and various disagreements with regard to the mammalian metabolites of these compounds, which in turn is largely a consequence of the lack of availability of authentic standards that would allow for the directed development and validation of expedient analytical methodologies. In the present study, we developed a method for the analysis of structurally-related flavanol metabolites using a wide range of authentic standards. Applying this method in the context of a human dietary intervention study using comprehensively characterized and standardized flavanol- and procyanidin-containing cocoa, we were able to identify the structurally-related (−)-epicatechin metabolites (SREM) postprandially extant in the systemic circulation of humans. Our results demonstrate that (−)-epicatechin-3′-β-D-glucuronide, (−)-epicatechin-3′-sulfate, and a 3′-O-methyl(−)-epicatechin-5/7-sulfate are the predominant SREM in humans, and further confirm the relevance of the stereochemical configuration in the context of flavanol metabolism. In addition, we also identified plausible causes for the previously reported discrepancies regarding flavanol metabolism, consisting to a significant extent of inter-laboratory differences in sample preparation (enzymatic treatment and sample conditioning for HPLC analysis) and detection systems. Thus, these findings may also aid in the establishment of consensus on this topic.

Accurate analysis of noble gas concentrations in small water samples and its application to fluid inclusions in stalagmites

The concentrations of dissolved noble gases in water are widely used as a climate proxy to determine noble gas temperatures (NGTs); i.e., the temperature of the water when gas exchange last occurred. In this paper we make a step forward to apply this principle to fluid inclusions in stalagmites in order to reconstruct the cave temperature prevailing at the time when the inclusion was formed. We present an analytical protocol that allows us accurately to determine noble gas concentrations and isotope ratios in stalagmites, and which includes a precise manometrical determination of the mass of water liberated from fluid inclusions. Most important for NGT determination is to reduce the amount of noble gases liberated from air inclusions, as they mask the temperature-dependent noble gas signal from the water inclusions. We demonstrate that offline pre-crushing in air to subsequently extract noble gases and water from the samples by heating is appropriate to separate gases released from air and water inclusions. Although a large fraction of recent samples analysed by this technique yields NGTs close to present-day cave temperatures, the interpretation of measured noble gas concentrations in terms of NGTs is not yet feasible using the available least squares fitting models. This is because the noble gas concentrations in stalagmites are not only composed of the two components air and air saturated water (ASW), which these models are able to account for. The observed enrichments in heavy noble gases are interpreted as being due to adsorption during sample preparation in air, whereas the excess in He and Ne is interpreted as an additional noble gas component that is bound in voids in the crystallographic structure of the calcite crystals. As a consequence of our study's findings, NGTs will have to be determined in the future using the concentrations of Ar, Kr and Xe only. This needs to be achieved by further optimizing the sample preparation to minimize atmospheric contamination and to further reduce the amount of noble gases released from air inclusions.

Purification of coronavirus virions for Cryo-EM and proteomic analysis

Purification of intact enveloped virus particles can be useful as a first step in understanding the structure and function of both viral and host proteins that are incorporated into the virion. Purified preparations of virions can be used to address these questions using techniques such as mass spectrometry proteomics. Recent studies on the proteome of coronavirus virions have shown that in addition to the structural proteins, accessory and non-structural virus proteins and a wide variety of host cell proteins associate with virus particles. To further study the presence of virion proteins, high quality sample preparation is crucial to ensure reproducible analysis by the wide variety of methods available for proteomic analysis.

Preface

The ‘soft’ ionization technique matrix-assisted laser desorption/ionization (MALDI) is without doubt one of the great success stories of modern mass spectrometry (MS). In particular, the further development of MALDI and in general ‘soft’ laser ionization, focusing on their unique characteristics and advantages in areas such as speed, spatial resolution, sample preparation and low spectral complexity, have led to great advances in mass spectral profiling and imaging with an extremely auspicious future in (bio)medical analyses.

PIXE analysis of chromium phytoaccumulation by the aquatic macrophytes Eicchornia crassipes

The uptake of hexavalent chromium in free living floating aquatic macrophytes Eicchornia crassipes cultivated in non-toxic chromium-doped hydroponic solutions is presented. A Cr-uptake bioaccumulation experiment was carried out using healthy macrophytes grown in a temperature controlled greenhouse. Six samples of nutrient media and plants were collected during the 23 day experiment. Roots and leaves were acid digested with the addition of an internal Gallium standard, for thin film sample preparation and quantitative Cr analysis by PIXE method. The Cr(6+) mass uptake by the macrophytes reached up to 70% of the initial concentration, comparable to former results and literature data. The Cr-uptake data were described using a non-structural first order kinetic model. Due to low cost and high removal efficiency, living aquatic macrophytes E. crassipes are a viable biosorbent in an artificial wetland of a water effluent treatment plant. (c) 2009 Elsevier B.V. All rights reserved.

Useful Strategies for Algal Volatile Analysis

The production of volatile organic compounds (VOC) by plants is well known. However, few scientific groups have studied VOC produced by green, brown and red algae. Headspace collection of volatiles and solid phase microextraction, as well as the traditional extraction by hydrodistillation combined with analytical chromatographic techniques (i.e., GC-MS), have significantly improved the investigation of VOC from plants and algae. The major volatile compounds found in seaweeds are hydrocarbons, terpenes, phenols, alcohols, aldehydes, ketones, esters, fatty acids and halogen or sulfur-containing compounds. This article presents an overview of VOC isolated from and identified in marine macro-algae. Focus is given to non-halogenated and non-sulfur volatile compounds, as well as strategies to analyze and identify algal VOC by GC-MS.

Determination of catechins in green tea infusions by reduced flow micellar electrokinetic chromatography

A sulfated-beta-cyclodextrin (s-beta-CD) modified reduced flow micellar electrokinetic chromatography (RF-MEKC) method was developed and validated for the determination of catechins in green tea. The optimal electrolyte consisted of 0.2% triethylamine, 50 mmol/L SDS and 0.8% s-beta-CD (pH = 2.9), allowing baseline separation of five catechins in 4 min. The samples and standards were injected at 0.6 psi for 5 s under constant voltage of -30 kV. Sample preparation simply involved extraction of 2 g of tea with 200 mL water at 95 C under constant stirring for 5 min. The method demonstrated excellent performance, with limits of detection (LOD) and quantification (LOQ) of 0.02-0.1 and 0.1-0.5 mu g/mL, respectively, and recovery percentages of 94-101%. The method was applied to six samples of Brazilian green tea infusions. Epigallocatechin gallate (23.4-112.4 mu g/mL) was the major component, followed by epigallocatechin (18.4-78.9 mu g/mL), epicatechin gallate (5.6-29.6 mu g/mL), epicatechin (4.6-14.5 mu g/mL) and catechin (3.2-8.2 mu g/mL). (C) 2011 Elsevier Ltd. All rights reserved.

Rapid method for the determination. of organic acids in wine by capillary electrophoresis with indirect UV detection

A capillary electrophoresis method for organic acids in wine was developed and validated. The optimal electrolyte consisted of 10 mmol/L 3,5-dinitrobenzoic acid (DNB) at pH 3.6 containing 0.2 mmol/L cetyltrimethylammonium bromide as flow reverser. DNB was chosen because it has an effective mobility similar to the organic acids under investigation, good buffering capacity at pH 3.6, and good chromophoric characteristics for indirect UV-absorbance detection at 254 nm. Sample preparation involved dilution and filtration. The method showed good performance characteristics: Linearity at 6 to 285 mg/L (r > 0.99); detection and quantification limits of 0.64 to 1.55 and 2.12 to 5.15 mg/L, respectively; separation time of less than 5.5 min. Coefficients of variation for ten injections were less than 5% and recoveries varied from 95% to 102%. Application to 23 samples of Brazilian wine confirmed good repeatability and demonstrated wide variation in the organic acid concentrations. (C) 2008 Elsevier Ltd. All rights reserved.