992 resultados para 14-BP POLYMORPHISM
Resumo:
The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.
Resumo:
Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The aim of this study was to evaluate the frequency of thyroid dysfunction and thyroid antibodies in patients with juvenile onset Systemic Lupus Erythematosus (JOSLE) and its association with clinical and immunological features. Seventy-seven patients with JOSLE, 64 females, median age 19 years, were consecutively enrolled from March to December 2007. Clinical data related to thyroid dysfunction and lupus were obtained by chart review and patient interview. Serum levels of TSH, free T4, anti-thyroglobulin (TgAb), anti-thyroperoxidase (TPOAb), TRAb and lupus related autoantibodies were analyzed by standard techniques. Nine patients were diagnosed as hypothyroidism and 4 hyperthyroidism. 28% JOSLE patients had moderate/high titer of thyroid antibodies: 23% TgAb, 2.6% TPOAb and 3.9% TRAb. JOSLE patients with positive thyroid autoantibodies had higher frequency of anti-U1RNP antibodies than patients without these antibodies (40.9 vs. 14.5%, OR:0.25, CI:0.08-0.76, p = 0.017). Furthermore, renal/neurological/hematological involvement was less frequently observed in patients with hypothyroidism (55.6 vs. 87.5%, OR:0.18, CI:0.04-0.81, p = 0.035) and with thyroid antibodies (68.4 vs. 90.9%, OR:0.22, CI:0.06-0.82. p = 0.027) than in patients without these alterations. No association with PTPN22 polymorphism was found. In conclusion, JOSLE patients have high prevalence of subclinical hypothyroidism. The novel association of anti-thyroid antibodies with anti-U1RNP antibodies in JOSLE seems to identify a subgroup of patients with less life-threatening organ involvement. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Objective. To evaluate whether the A/G polymorphism at position 2518 in the regulatory region of the monocyte chemoattractant protein-1 (MCP-1) or the V/I polymorphism at position 64 of the receptor. CCR2, are associated with lupus nephritis (LN) or any clinical characteristics of the disease or with renal survival in a patient population. Methods. We selected 197 patients with lupus nephritis and 220 matched healthy controls for study. MCP-1 and CCR2 genotyping was performed by polymerase chain reaction. Clinical and laboratory data were compiled from patients` charts over followup that ranged from 6 months to 10 years. Results. The GIG genotype of MCP-1 was more common in LN patients (p = 0.019), while the A allele was associated with healthy controls (p = 0.007) as was the V allele of CCR2 (p = 0.046) compared to LN patients. Clinical index measures [SLE Disease Activity Index (SLEDAI)], immunological markers, renal histology, renal function at enrollment, and renal survival were not influenced by these polymorphisms. A less aggressive renal disease, measured by renal SLEDAI index, was associated with the V allele of the CCR2 gene polymorphism. Conclusion. These findings support that MCP-1 2518 GIG is associated with LN but there was no association of this genotype with renal function or renal survival. When studying CCR2 64 V/I polymorphism we showed a positive association of the V allele with healthy controls but no association of the genotype with LN patients. (First Release March 152010; J Rheumatol 2010;37:776-82; doi:10.3899/jrheum.090681)
Resumo:
HLA-G is a non-classic Human Leukocyte Antigen (HLA-G) Class I of low polymorphism and restricted tissue distribution that displays tolerogenic functions. In heart transplantation and in combined liver/renal allograft transplantation, the expression of HLA-G has been associated with a lower incidence of acute graft rejection episodes and absence of chronic dysfunction. Since the expression of HLA-G in renal biopsies has been investigated only in few patients who received a combined kidney and liver transplant, in this study we performed a cross-sectional study, systematically comparing the expression of HLA-G in post-transplanted renal grafts, stratifying patients according to the presence or absence of rejection. Patients and Methods: Seventy-three renal specimens (10 with acute rejection and 13 with chronic allograft nephropathy, and 50 with no signs of rejection) were immunohistochemically evaluated for HLA-G expression. Results: In the group as a whole, HLA-G molecules were detected in 40 cases (54.8%). Among specimens that presented HLA-G expression, 2 out of 40 (5%) exhibited acute rejection, 2 (5%) exhibited chronic allograft nephropathy, and the remaining 36 (90%) exhibited no signs of rejection. The comparison between patients with rejection and those without rejection showed that the expression of HLA-G was significantly increased in specimens exhibiting no signs of rejection (p<0.0001). Considering only patients with acute rejection, 8 out of 10 patients showed no HLA-G expression in their kidney biopsies when compared to patients exhibiting no signs of rejection and absence of HLA-G was observed in 14 out of 50 (p=0.0032). Similarly, considering only patients with chronic allograft nephropathy, absence of HLA-G expression was observed in I I out of 13 specimens, whereas in patients without rejection absence of HLA-G was observed in 14 out of 50 (p=0.003). Therapy with tacrolimus was significantly associated with the expression of HLA-G and a better graft prognosis. Conclusions: Our results suggest that HLA-G expression in the kidney allograft and the use of tacrolimus are associated with a lower frequency of acute renal rejection and chronic allograft nephropathy. (c) 2007 Elsevier B.V. All rights reserved.
Resumo:
Background: Forearm blood flow responses during mental stress are greater in individuals homozygous for the Glu27 allele. A high-fat meal is associated with impaired endothelium-dependent dilatation. We investigated the impact of high-fat ingestion on the muscle vasodilatory responses during mental stress in individuals with the Glu27 allele and those with the Gln27 allele of the beta(2)-adrenoceptor gene. Methods: A total of 162 preselected individuals were genotyped for the Glu27Gln beta(2)-adrenoceptor polymorphism. Twenty-four individuals participated in the study. Fourteen were homozygous for the Gln27 allele (Gln27Gln, 40 +/- 2 years; 64 +/- 2 kg), and 10 were homozygous for the Glu27 allele (Glu27Glu, 40 +/- 3 years; 65 +/- 3 kg). Forearm blood flow was evaluated by venous occlusion plethysmography before and after ingestion of 62 g of fat. Results: The high-fat meal caused no changes in baseline forearm vascular conductance (FVC, 2.2 +/- 0.1 vs. 2.4 +/- 0.2; P = 0.27, respectively), but reduced FVC responses to mental stress (1.5 +/- 0.2 vs. 0.8 +/- 0.2 units; P = 0.04). When volunteers were divided according to their genotypes, baseline FVC was not different between groups (Glu27Glu = 2.4 +/- 0.1 vs. Gln27Gln = 2.1 +/- 0.1 units; P = 0.08), but it was significantly greater in Glu27Glu individuals during mental stress (1.9 +/- 0.4 vs. 1.0 +/- 0.3 units; P = 0.04). High-fat intake eliminated the difference in FVC responses between Glu27Glu and Gln27Gln individuals (FVC, 1.3 +/- 0.4 vs. 1.2 +/- 0.4; P = 0.66, respectively). Conclusion: These findings demonstrate that a high-fat meal impairs muscle vasodilatation responses to mental stress in humans. However, this reduction can be attributed to the presence of the homozygous Glu27 allele of the beta(2)-adrenoceptor gene.
Resumo:
Introduction: Association between ADAMTS13 levels and cardiovascular events has been described recently. However, no genetic study of ADAMTS13 in coronary patients has been described. Materials and Methods: Based on related populations frequencies and functional studies, we tested three ADAMTS13 polymorphisms: C1342G (Q448E), C1852G (P618A) and C2699T (A900V) in a group of 560 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. The incidence of the 5-year end-points of death and death from cardiac causes, myocardial infarction, refractory angina requiring revascularization and cerebrovascular accident was determined for each polymorphim`s allele, genotype and haplotype. Risk was assessed with the use of logistic regression and Cox proportional-hazards model and multivariable adjustment was employed for possible confounders. Results: Clinical characteristics and received treatment of each genotype group were similar at baseline. In an adjusted model for cardiovascular risk variables, we were able to observe a significant association between ADAMTS13 900V variant and an increased risk of death (OR: 1,92 CI: 1,14-3,23, p = 0,015) or death from cardiac cause (OR: 2,67, CI: 1,59-4,49, p = 0,0009). No association between events and ADAMTS13 Q448E or P618A was observed. Conclusions: This first report studying the association between ADAMTS13 genotypes and cardiovascular events provides evidence for the association between ADAMTS13 900V variant and an increased risk of death in a population with multi-vessel CAD. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Background: The angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism gene contributes to the genesis of hypertension (HTN) and may help explain the relationship between obstructive sleep apnea (OSA) and HTN. However, ACE is a pleiotropic gene that has several influences, including skeletal muscle and control of ventilation. We therefore tested the hypothesis that ACE polymorphism influences OSA severity. Methods: Male OSA patients (apnea-hypopnea index [AHI] > 5 events/h) from 2 university sleep centers were evaluated by polysomnography and ACE I/D polymorphism genotyping. Results: We studied 266 males with OSA (age = 48 +/- 13y, body mass index = 29 5kg/m(2), AHI = 34 +/- 25events/h). HTN was present in 114 patients (43%) who were older (p < 0.01), heavier (p < 0.05) and had more severe OSA (p < 0.01). The I allele was associated with HTN in patients with mild to moderate OSA (p < 0.01), but not in those with severe OSA. ACE I/D polymorphism was not associated with apnea severity among normotensive patients. In contrast. the only variables independently associated with OSA severity among patients with hypertension in multivariate analysis were BMI (OR = 1.12) and 11 genotype (OR = 0.27). Conclusions: Our results indicate reciprocal interactions between OSA and HTN with ACE I/D polymorphism, suggesting that among hypertensive OSA males, the homozygous ACE I allele protects from severe OSA. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
Objective Cardiovascular risk factors were surveyed in two Indian populations (Guarani, n=60; Tupinikin, n=496) and in a non-Indian group (n=114) living in the same reserve in southeast Brazilian coast. The relationship between an age-dependent blood pressure (BP) increase with salt consumption was also investigated. Methods Overnight (12 h) urine was collected to evaluate Na excretion. Fasting glucose and lipids, anthropometry, BP, ECG and carotid-femoral pulse wave velocity (PWV) were measured in a clinic visit. Participation (318 men/352 women, age 20-94 years; mean=37.6 +/- 14.9 years) comprised 80% of the eligible population. Results The prevalence of hypertension, diabetes and high cholesterol was similar in Tupinikins and in non-Indians and higher than in Guaranis. The prevalence of smoking and obesity was higher in the latter group. Hypertension and diabetes were detected in only one individual of the Guarani group. Mean BP adjusted to age and BMI was significantly lower (P<0.01) in Guaranis (82.8 +/- 1.6 mmHg) than in Tupinikins (92.3 +/- 0.5 mmHg) and non-Indians (91.6 +/- 1.1 mmHg). Urinary Na excretion (mEq/12h), however, was similar in the three groups (Guarani=94 +/- 40; Tupinikin=105 +/- 56; non-Indian=109 +/- 55; P>0.05). PWV (m/s) was lower (P<0.01) in Guarani (7.5 +/- 1.4) than in Tupinikins (8.8 +/- 2.2) and non-Indians (8.4 +/- 2.0). Multiple regression analysis showed that age and waist-to-hip ratio (WHR) were independent predictors of SBP and DBP (r(2)=0.44) in Tupinikins, whereas the WHR was the unique independent predictor of BP variability in Guaranis (r(2)=0.22). Conclusion Lower BP levels in Guaranis cannot be explained by low salt intake observed in other primitive populations. J Hypertens 27:1753-1760 (C) 2009 Wolters Kluwer Health vertical bar Lippincott Williams & Wilkins.
Resumo:
In this paper we completely settle the embedding problem for m-cycle systems with m less than or equal to 14. We also solve the more general problem of finding m-cycle systems of K-v - K-u when m is an element of {4,6,7,8,10,12,14}.
Resumo:
Arg72Pro is a common polymorphism in TP53, showing differences in its biological functions. Case-control studies have been performed to elucidate the role of Arg72Pro in cancer, although the results are conflicting and heterogeneous. Here, we analyzed pooled data from case-control studies to determine the role of Arg72Pro in different cancer sites. We performed a systematic review and meta-analysis of 302 case-control studies that analyzed Arg72Pro in cancer susceptibility. Odds ratios were estimated for different tumor sites using distinct genetic models, and the heterogeneity between studies was explored using I(2) values and meta-regression. We adopted quality criteria to classify the studies. Subgroup analyses were done for tumor sites according to ethnicity, histological, and anatomical sites. Results indicated that Arg72Pro is associated with higher susceptibility to cancer in some tumor sites, mainly hepatocarcinoma. For some tumor sites, quality of studies was associated with the size of genetic association, mainly in cervical, head and neck, gastric, and lung cancer. However, study quality did not explain the observed heterogeneity substantially. Meta-regression showed that ethnicity, allelic frequency and genotyping method were responsible for a substantial part of the heterogeneity observed. Our results suggest ethnicity and histological and anatomical sites may modulate the penetrance of Arg72Pro in cancer susceptibility. This meta-analysis denotes the importance for more studies with good quality and that the covariates responsible for heterogeneity should be controlled to obtain a more conclusive response about the function of Arg72Pro in cancer.
Resumo:
Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.
Resumo:
Background: Epidermodysplasia verruciformis (EV) is a rare genodermatosis with susceptibility to human papillomavirus (HPV) infection, and high risk of skin cancer considered a model of viral oncogenesis. Methods: Fifteen cases of EV plane wart (PW)-type lesions (EV) and 14 cases of PW in healthy individuals were subjected to immunohistochemical technique for cytokeratins (K) 1, 10, 14, 16, 4, involucrin, filaggrin and e-cadherin. Results: K1/10 showed retarded or negative expression in EV, being substituted by K14. Expression of K14 occurred in the basal and suprabasal layers in both groups, but in EV, its expression was observed up to the more superficial layers. Both groups showed positivity for K16 and K4, involucrin expression in lower levels of the spinous layer and unaltered filaggrin expression. E-cadherin expression was diminished at the koilocytotic foci of both lesions, more superficially in EV. Conclusion: Infection by HPV may alter the differentiation status of the epidermis, leading to a major expression of K14, delayed or absent expression of K1/10 and earlier involucrin expression, especially in EV. It also stimulates the expression of K16 and K4. Filaggrin expression is not altered, and e-cadherin is diminished in superficial koilocytotic cells` foci in EV.
Resumo:
The outflow-concentration-time profiles for lignocaine (lidocaine) and its metabolites have been measured after bolus impulse administration of [C-14]lignocaine into the perfused rat liver. Livers from female Sprague-Dawley rats were perfused in a once-through fashion with red-blood-cell-free Krebs-Henseleit buffer containing 0 or 2% bovine serum albumin. Perfusate flow rates of 20 and 30 mL min(-1) were used and both normal and retrograde flow directions were employed. Significant amounts of metabolite were detected in the effluent perfusate soon after lignocaine injection. The early appearance of metabolite contributed to bimodal outflow profiles observed for total C-14 radioactivity. The lignocaine outflow profiles were well characterized by the two-compartment dispersion model, with efflux rate << influx rate. The profiles for lignocaine metabolites were also characterized in terms of a simplified two-compartment dispersion model. Lignocaine was found to be extensively metabolized under the experimental conditions with the hepatic availability ranging between 0.09 and 0.18. Generally lignocaine and metabolite availability showed no significant change with alterations in perfusate flow rate from 20 to 30 mt min(-1) or protein content from 0 to 2%. A significant increase in lignocaine availability occurred when 1200 mu M unlabelled lignocaine was added to the perfusate. Solute mean transit times generally decreased with increasing flow rate and with increasing perfusate protein content. The results confirm that lignocaine pharmacokinetics in the liver closely follow the predictions of the well-stirred model. The increase in lignocaine availability when 1200 mu M unlabelled lignocaine was added to the perfusate is consistent with saturation of the hydroxylation metabolic pathways of lignocaine metabolism.