Persistent infection of rhesus macaques with T-cell-line-tropic and macrophage-tropic clones of simian/human immunodeficiency viruses (SHIV).

To elucidate the functions of human immunodeficiency virus type 1 (HIV-1) genes in a nonhuman primate model, we have constructed infectious recombinant viruses (chimeras) between the pathogenic molecular clone of simian immunodeficiency virus (SIV) SIVmac239 and molecular clones of HIV-1 that differ in phenotypic properties controlled by the env gene. HIV-1SF33 is a T-cell-line-tropic virus which induces syncytia, and HIV-1SF162 is a macrophage-tropic virus that does not induce syncytia. A DNA fragment encoding tat, rev, and env (gp160) of SIVmac239 has been replaced with the counterpart genetic region of HIV-1SF33 and HIV-1SF162 to derive chimeric recombinant simian/human immunodeficiency virus (SHIV) strains SHIVSF33 and SHIVSF162, respectively. In the acute infection stage, macaques inoculated with SHIVSF33 had levels of viremia similar to macaques infected with SIVmac239, whereas virus loads were 1/10th to 1/100th those in macaques infected with SHIVSF162. Of note is the relatively small amount of virus detected in lymph nodes of SHIVSF162-infected macaques. In the chronic infection stage, macaques infected with SHIVSF33 also showed higher virus loads than macaques infected with SHIVSF162. Virus persists for over 1 year, as demonstrated by PCR for amplification of viral DNA in all animals and by virus isolation in some animals. Antiviral antibodies, including antibodies to the HIV-1 env glycoprotein (gp160), were detected; titers of antiviral antibodies were higher in macaques infected with SHIVSF33 than in macaques infected with SHIVSF162. Although virus has persisted for over 1 year after inoculation, these animals have remained healthy with no signs of immunodeficiency. These findings demonstrate the utility of the SHIV/macaque model for analyzing HIV-1 env gene functions and for evaluating vaccines based on HIV-1 env antigens.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

The murine stk gene product, a transmembrane protein tyrosine kinase, is a receptor for macrophage-stimulating protein.

Macrophage-stimulating protein (MSP) was originally identified as an inducer of murine resident peritoneal macrophage responsiveness to chemoattractants. We recently showed that the product of RON, a protein tyrosine kinase cloned from a human keratinocyte library, is the receptor for MSP. Similarity of murine stk to RON led us to determine if the stk gene product is the murine receptor for MSP. Radiolabeled MSP could bind to NIH 3T3 cells transfected with murine stk cDNA (3T3/stk). Binding was saturable and was inhibited by unlabeled MSP but not by structurally related proteins, including hepatocyte growth factor and plasminogen. Specific binding to STK was demonstrated by cross-linking of 125I-labeled MSP to membrane proteins of 3T3/stk cells, which resulted in a protein complex with a molecular mass of 220 kDa. This radiolabeled complex comprised 125I-MSP and STK, since it could be immunoprecipitated by antibodies to the STK beta chain. Binding of MSP to stk cDNA-transfected cells induced tyrosine phosphorylation of the 150-kDa STK beta chain within 1 min and caused increased motile activity. These results establish the murine stk gene product as a specific transmembrane protein tyrosine kinase receptor for MSP. Inasmuch as the stk cDNA was cloned from a hematopoietic stem cell, our data suggest that in addition to macrophages and keratinocytes, a cell in the hematopoietic lineage may also be a target for MSP.

Expression cloning of dSR-CI, a class C macrophage-specific scavenger receptor from Drosophila melanogaster.

Mammalian class A macrophage-specific scavenger receptors (SR-A) exhibit unusually broad binding specificity for a wide variety of polyanionic ligands. The properties of these receptors suggest that they may be involved in atherosclerosis and host defense. We have previously observed a similar receptor activity in Drosophila melanogaster embryonic macrophages and in the Drosophila macrophage-like Schneider L2 cell line. Expression cloning was used to isolate from L2 cells a cDNA that encodes a third class (class C) of scavenger receptor, Drosophila SR-CI (dSR-CI). dSR-CI expression was restricted to macrophages/hemocytes during embryonic development. When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation. Although the broad polyanionic ligand-binding specificity of dSR-CI was similar to that of SR-A, their predicted protein sequences are not similar. dSR-CI is a 609-residue type I integral membrane protein containing several well-known sequence motifs, including two complement control protein (CCP) domains and somatomedin B, MAM, and mucin-like domains. Macrophage scavenger receptors apparently mediate important, well-conserved functions and may be pattern-recognition receptors that arose early in the evolution of host-defense mechanisms. Genetic and physiologic analysis of dSR-CI function in Drosophila should provide further insights into the roles played by scavenger receptors in host defense and development.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

S100B up-regulates macrophage production of IL1β and CCL22 and influences severity of retinal inflammation

Funding: This work was supported by funding awards to Dr Isabel Crane from the National Eye Research Centre, Bristol, UK (Grant ref. SCIAD 058); and NHS Grampian Endowment Trust (Grant ref. 10/16). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

An Arginine Deprivation Response Pathway Is Induced in Leishmania during Macrophage Invasion

Amino acid sensing is an intracellular function that supports nutrient homeostasis, largely through controlled release of amino acids from lysosomal pools. The intracellular pathogen Leishmania resides and proliferates within human macrophage phagolysosomes. Here we describe a new pathway in Leishmania that specifically senses the extracellular levels of arginine, an amino acid that is essential for the parasite. During infection, the macrophage arginine pool is depleted due to its use to produce metabolites (NO and polyamines) that constitute part of the host defense response and its suppression, respectively. We found that parasites respond to this shortage of arginine by up-regulating expression and activity of the Leishmania arginine transporter (LdAAP3), as well as several other transporters. Our analysis indicates the parasite monitors arginine levels in the environment rather than the intracellular pools. Phosphoproteomics and genetic analysis indicates that the arginine-deprivation response is mediated through a mitogen-activated protein kinase-2-dependent signaling cascade.

A macrophage colony-stimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse

The c-fms gene encodes the receptor for macrophage colony-stimulating factor (CSF-1). The gene is expressed selectively in the macrophage and trophoblast cell lineages. Previous studies have indicated that sequences in intron 2 control transcript elongation in tissue-specific and regulated expression of c-fms. In humans, an alternative promoter was implicated in expression of the gene in trophoblasts. We show that in mice, c-fms transcripts in trophoblasts initiate from multiple points within the 2-kilobase (kb) region flanking the first coding exon. A reporter gene construct containing 3.5 kb of 5' flanking sequence and the down-stream intron 2 directed expression of enhanced green fluorescent protein (EGFP) to both trophoblasts and macrophages. EGFP was detected in trophoblasts from the earliest stage of implantation examined at embryonic day 7.5. During embryonic development, EGFP highlighted the large numbers of c-fms-positive macrophages, including those that originate from the yolk sac. In adult mice, EGFP location Was consistent with known F4/80-positive macrophage populations, including Langerhans cells of the skin, and permitted convenient sorting of isolated tissue macrophages from disaggregated tissue. Expression of EGFP in transgenic mice was dependent on intron 2 as no lines with detectable EGFP expression were obtained where either all of intron 2 or a conserved enhancer element FIRE (the Fms intronic regulatory element) was removed. We have therefore defined the elements required to generate myeloid- and trophoblast-specific transgenes as well as a model system for the study of mononuclear phagocyte development and function. (C) 2003 by The American Society of Hematology.

CSF-1 as a regulator of macrophage activation and immune responses

Macrophage activation is a key determinant of susceptibility and pathology in a variety of inflammatory diseases. The extent of macrophage activation is tightly regulated by a number of pro-inflammatory cytokines (e.g. IFN-gamma, IL-2, GM-CSF, IL-3) and anti-inflammatory cytokines (e.g. IL-4, IL-10, TGF-beta). Macrophage colony-stimulating factor (CSF-1/M-CSF) is a key differentiation, growth and survival factor for monocytes/macrophages and osteoclasts. The role of this factor in regulating macrophage activation is often overlooked. This review will summarize our current understanding of the effects of CSF-1 on the activation state of mature macrophages and its role in regulating immune responses.

L-arginine-dependent nitric oxide production of a murine macrophage-like RAW 264.7 cell line stimulated with Porphyromonas gingivalis lipopolysaccharide

The aim of this study was to determine nitric oxide (NO) production of a murine macrophage cell line (RAW 264.7 cells) when stimulated with Porphyromonas gingivalis lipopolysaccharides (Pg-LPS). RAW264.7 cells were incubated with i) various concentrations of Pg-LPS or Salmonella typhosa LPS (St-LPS), ii) Pg-LPS with or without L-arginine and/or N-G-monomethyl-L-arginine (NMMA), an arginine analog or iii) Pg-LPS and interferon-gamma (IFN-gamma) with or without anti-IFN-gamma antibodies or interleukin-10 (IL-10). Tissue culture supernatants were assayed for NO levels after 24 h in culture. NO was not observed in tissue culture supernatants of RAW 264.7 cells following stimulation with Pg-LPS, but was observed after stimulation with St-LPS. Exogenous L-arginine restored the ability of Pg-LPS to induce NO production; however, the increase in NO levels of cells stimulated with Pg-LPS with exogenous L-arginine was abolished by NMMA. IFN-gamma induced independent NO production by Pg-LPS-stimulated macrophages and this stimulatory effect of IFN-gamma could be completely suppressed by anti-IFN-gamma antibodies and IL-10. These results suggest that Pg-LPS is able to stimulate NO production in the RAW264.7 macrophage cell model in an L-arginine-dependent mechanism which is itself independent of the action of IFN-gamma.

Differences in macrophage activation by bacterial DNA and CpG-containing oligonucleotides

Bacterial DNA activates mouse macrophages, B cells, and dendritic cells in a TLR9-dependent manner. Although short ssCpG-containing phosphodiester oligonucleotides (PO-ODN) can mimic the action of bacterial DNA on macrophages, they are much less immunostimulatory than Escherichia coli DNA. In this study we have assessed the structural differences between E. coli DNA and PO-ODN, which may explain the high activity of bacterial DNA on macrophages. DNA length was found to be the most important variable. Double-strandedness was not responsible for the increased activity of long DNA. DNA adenine methyltransferase (Dam) and DNA cytosine methyltransferase (Dcm) methylation of E. coli DNA did not enhance macrophage NO production. The presence of two CpG motifs on one molecule only marginally improved activity at low concentration, suggesting that ligand-mediated TLR9 cross-linking was not involved. The major contribution was from DNA length. Synthetic ODN > 44 nt attained the same levels of activity as bacterial DNA. The response of macrophages to CpG DNA requires endocytic uptake. The length dependence of the CpG ODN response was found to correlate with the presence in macrophages of a length-dependent uptake process for DNA. This transport system was absent from B cells and fibroblasts.