934 resultados para barrier integrity
Resumo:
An analytical theory to describe the combined effects of the epitaxial layer thickness and the ohmic contact on the noise properties of Schottky barrier diodes is presented. The theory, which provides information on both the local and the global noise properties, takes into account the finite size of the epitaxial layer and the effects of the back ohmic contact, and applies to the whole range of applied bias. It is shown that by scaling down the epitaxial layer thickness, the current regime in which the noise temperature displays a shot-noise-like behavior increases at the cost of reducing the current range in which the thermal-noise-like behavior dominates. This improvement in noise temperature is limited by the effects of the ohmic contact, which appear for large currents. The theory is formulated on general trends, allowing its application to the noise analysis of other semiconductor devices operating under strongly inhomogeneous distributions of the electric field and charge concentrations.
Resumo:
The main objective of the present study was to verify the approach on starch-gelatin blending for the paperboard coating formulations with enhanced barrier and mechanical properties. Based on that, another objective was to find out, how the approach will function with wood-based polysaccharides (CMC, EHEC and HPC) by analyzing their barrier properties and convertibility. The last objective was to find out, if pigments can be used in the composition of polysaccharide-protein blends without causing any negative effect on stated properties. The whole process chain of the barrier coating development was studied in the research. The methodology applied included pilot-scale coating and converting trials for the evaluation of mechanical properties of obtained coatings, namely their exposure to cracking with the loss of barrier properties. The results obtained indicated that the combination of starch with gelatin, in fact, improves the grease barrier properties and flexibility of starch-based coatings, thereby confirming the offered approach. The similar results were obtained for CMC, exhibited elevated barrier properties and surface coverage, proving that the approach also functions with wood-based polysaccharides. The introduction of equal amounts of talc gave various effects at different gelatin dosages on barrier properties of wood-based polysaccharides. Mainly, the elevation of grease barrier properties was observed. The convertibility of talc-filled coatings was not sufficient.
Resumo:
Presentation at Open Repositories 2014, Helsinki, Finland, June 9-13, 2014
Resumo:
The main objective of the present study was to analyze the best approach on how to coat paperboard trays at the pressing stage. The coating gives the paperboard enhanced barrier and mechanical properties. The whole process chain of the barrier coating development was studied in the research. The methodology applied includes obtaining the optimum temperature at which good adhesion and bonding is formed between paperboard and skin film. Evaluation of mechanical properties after the coatings; such as cracking, curling and barrier properties was performed.
Resumo:
Tool center point calibration is a known problem in industrial robotics. The major focus of academic research is to enhance the accuracy and repeatability of next generation robots. However, operators of currently available robots are working within the limits of the robot´s repeatability and require calibration methods suitable for these basic applications. This study was conducted in association with Stresstech Oy, which provides solutions for manufacturing quality control. Their sensor, based on the Barkhausen noise effect, requires accurate positioning. The accuracy requirement admits a tool center point calibration problem if measurements are executed with an industrial robot. Multiple possibilities are available in the market for automatic tool center point calibration. Manufacturers provide customized calibrators to most robot types and tools. With the handmade sensors and multiple robot types that Stresstech uses, this would require great deal of labor. This thesis introduces a calibration method that is suitable for all robots which have two digital input ports free. It functions with the traditional method of using a light barrier to detect the tool in the robot coordinate system. However, this method utilizes two parallel light barriers to simultaneously measure and detect the center axis of the tool. Rotations about two axes are defined with the center axis. The last rotation about the Z-axis is calculated for tools that have different width of X- and Y-axes. The results indicate that this method is suitable for calibrating the geometric tool center point of a Barkhausen noise sensor. In the repeatability tests, a standard deviation inside robot repeatability was acquired. The Barkhausen noise signal was also evaluated after recalibration and the results indicate correct calibration. However, future studies should be conducted using a more accurate manipulator, since the method employs the robot itself as a measuring device.
Resumo:
Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.
Resumo:
Alpha-Hemolysin is synthesized as a 1024-amino acid polypeptide, then intracellularly activated by specific fatty acylation. A second activation step takes place in the extracellular medium through binding of Ca2+ ions. Even in the absence of fatty acids and Ca2+ HlyA is an amphipathic protein, with a tendency to self-aggregation. However, Ca2+-binding appears to expose hydrophobic patches on the protein surface, facilitating both self-aggregation and irreversible insertion into membranes. The protein may somehow bind membranes in the absence of divalent cations, but only when Ca2+ (or Sr2+, or Ba2+) is bound to the toxin in aqueous suspensions, i.e., prior to its interaction with bilayers, can a-hemolysin bind irreversibly model or cell membranes in such a way that the integrity of the membrane barrier is lost, and cell or vesicle leakage ensues. Leakage is not due to the formation of proteinaceous pores, but rather to the transient disruption of the bilayer, due to the protein insertion into the outer membrane monolayer, and subsequent perturbations in the bilayer lateral tension. Protein or glycoprotein receptors for a-hemolysin may exist on the cell surface, but the toxin is also active on pure lipid bilayers.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Obesity is one of the key challenges to health care system worldwide and its prevalence is estimated to rise to pandemic proportions. Numerous adverse health effects follow with increasing body weight, including increased risk of hypertension, diabetes, hypercholesterolemia, musculoskeletal pain and cancer. Current evidence suggests that obesity is associated with altered cerebral reward circuit functioning and decreased inhibitory control over appetitive food cues. Furthermore, obesity causes adverse shifts in metabolism and loss of structural integrity within the brain. Prior cross-sectional studies do not allow delineating which of these cerebral changes are recoverable after weight loss. We compared morbidly obese subjects with healthy controls to unravel brain changes associated with obesity. Bariatric surgery was used as an intervention to study which cerebral changes are recoverable after weight loss. In Study I we employed functional magnetic resonance imaging (fMRI) to detect the brain basis of volitional appetite control and its alterations in obesity. In Studies II-III we used diffusion tensor imaging (DTI) and voxel-based morphometry (VBM) to quantify the effects of obesity and the effects of weight loss on structural integrity of the brain. In study IV we used positron emission tomography (PET) with [18F]-FDG in fasting state and during euglycemic hyperinsulinemia to quantify effects of obesity and weight loss on brain glucose uptake. The fMRI experiment revealed that a fronto-parietal network is involved in volitional appetite control. Obese subjects had lower medial frontal and dorsal striatal brain activity during cognitive appetite control and increased functional connectivity within the appetite control circuit. Obese subjects had initially lower grey matter and white matter densities than healthy controls in VBM analysis and loss of integrity in white matter tracts as measured by DTI. They also had initially elevated glucose metabolism under insulin stimulation but not in fasting state. After the weight loss following bariatric surgery, obese individuals’ brain volumes recovered and the insulin-induced increase in glucose metabolism was attenuated. In conclusion, obesity is associated with altered brain function, coupled with loss of structural integrity and elevated glucose metabolism, which are likely signs of adverse health effects to the brain. These changes are reversed by weight loss after bariatric surgery, implicating that weight loss has a causal role on these adverse cerebral changes. Altogether these findings suggest that weight loss also promotes brain health.Key words: brain, obesity, bariatric surgery, appetite control, structural magnetic resonance
Resumo:
The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.
Resumo:
The aim of this study was to assess the desiccation tolerance and DNA integrity in Eugenia pleurantha seeds dehydrated to different moisture contents (MCs). Seeds extracted from mature fruits were submmited to drying in silica gel and evaluated at every five percentual points of decrease from the initial MC (35.5%, fresh weight basis). The effects of dehydration on seeds were verified through germination tests and DNA integrity assessment. Undried seeds achieved 87% germination, value reduced to 36% after being dried to 9.8% MC. When dried slightly more, to 7.4% MC, seeds were no longer able to germinate, suggesting an intermediate behavior in relation to desiccation tolerance. It was observed DNA degradation in seeds with 7.4% MC, which might have contributed to the loss of seed germination.
Resumo:
The aim of this study was to assess the desiccation tolerance and DNA integrity in Eugenia pleurantha seeds dehydrated to different moisture contents (MCs). Seeds extracted from mature fruits were dried in silica gel and evaluated at every five percentual points of decrease from the initial MC (35.5%, fresh weight basis). The effects of dehydration on seeds were verified through germination tests and DNA integrity assessment. Undried seeds achieved 87% germination, value reduced to 36% after being dried to 9.8% MC. When dried slightly more, to 7.4% MC, seeds were no longer able to germinate, suggesting an intermediate behavior in relation to desiccation tolerance. DNA degradation was observed in seeds with 7.4% MC, which might have contributed to the loss of seed germination.