Optimization of parameters of chemical spray pyrolysis technique to get n and p-type layers of SnS

SnS thin films were prepared using automated chemical spray pyrolysis (CSP) technique. Single-phase, p-type, stoichiometric, SnS films with direct band gap of 1.33 eV and having very high absorption coefficient (N105/cm) were deposited at substrate temperature of 375 °C. The role of substrate temperature in determining the optoelectronic and structural properties of SnS films was established and concentration ratios of anionic and cationic precursor solutions were optimized. n-type SnS samples were also prepared using CSP technique at the same substrate temperature of 375 °C, which facilitates sequential deposition of SnS homojunction. A comprehensive analysis of both types of films was done using x-ray diffraction, energy dispersive x-ray analysis, scanning electron microscopy, atomic force microscopy, optical absorption and electrical measurements. Deposition temperatures required for growth of other binary sulfide phases of tin such as SnS2, Sn2S3 were also determined

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Reactions of methylvinyl and phenylvinyl ketones with a tricyclic ketone derived from 2-tetralone: characterization of crystalline products by X-ray diffraction

Base catalysed reaction of the tricyclic ketone (6 ⇌ 7) with methylvinyl ketone gave the tetracyclic ketols, 11, 13, 15, 16, and the pentacyclic ketols, 12, 17. With phenylvinyl ketone, the tetracyclic ketol (18) was formed. The stereostructures of the ketols were identified by X-Ray diffraction. The base-catalysed title reactions gave the cyclic ketols and derived compounds shown below whose structures were identified by X-ray diffraction.

Reaction of (±)-1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-phosH} with copper(II), cobalt(II) and iron(II) compounds; Identification by x-ray diffraction of [Co(CH3OH)4(H2O)2][(+)-phos][(−)-phos]. 2CH3OH·H2O

[Cu2(μO2CCH3)4(H2O)2], [CuCO3·Cu(OH)2], [CoSO4·7H2O], [Co((+)-tartrate)], and [FeSO4·7H2O] react with excess racemic (±)- 1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-PhosH} to give mononuclear CuII, CoII and FeII products. The cobalt product, [Co(CH3OH)4(H2O)2]((+)-Phos)((−)-Phos) ·2CH3OH·H2O (7), has been identified by X-ray diffraction. The high-spin, octahedral CoII atom is ligated by four equatorial methanol molecules and two axial water molecules. A (+)- and a (−)-Phos− ion are associated with each molecule of the complex but are not coordinated to the metal centre. For the other CoII, CuII and FeII samples of similar formulation to (7) it is also thought that the Phos− ions are not bonded directly to the metal. When some of the CuII and CoII samples are heated under high vacuum there is evidence that the Phos− ions are coordinated directly to the metals in the products.

X-ray diffraction study of the influence of temperature on the structural correlations of poly(2-hydroxypropyl ether of bisphenol A)

The X-ray diffraction pattern of glassy poly(2-hydroxypropyl ether of bisphenol A) is studied at room temperature on oriented samples in order to associate its different peaks to different structural correlations. On the other hand, X-ray diffraction patterns have been obtained at different temperatures from Tg − 50 K up to Tg + 50 K for the above-mentioned polymer. Attention has been paid to the evolution with temperature of the position of the wide diffraction maximum corresponding to interchain correlations in the polymer. The temperature evolution of this parameter shows a marked discontinuity just at the glass transition temperature.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

A scanning electron microscopy study of diseased root surfaces conditioned with EDTA gel plus Cetavlon after scaling and root planing

In the present investigation, a scanning electron microscopy analysis was performed to evaluate the effects of the topical application of ethylenediaminetetraacetic acid (EDTA) gel associated with Cetavlon (EDTAC) in removing the smear layer and exposing collagen fibers following root surface instrumentation. Twenty-eight teeth from adult humans, single rooted and scheduled for extraction due to periodontal reasons, were selected. Each tooth was submitted to manual (scaling and root planing) instrumentation alone or combined with ultrasonic instruments, with or without etching using a 24% EDTAC gel. Following extraction, specimens were processed and examined under a scanning electron microscope. A comparative morphological semi-quantitative analysis was performed; the intensity of the smear layer and the decalcification of cementum and dentinal surfaces were graded in 12 sets using an arbitrary scale ranging from 1 (area covered by a smear layer) to 4 (no smear layer). Root debridement with hand instruments alone or combined with ultrasonic instruments resulted in a similar smear layer covering the root surfaces. The smear layer was successfully removed from the surfaces treated with EDTAC, which exhibited numerous exposed dentinal tubules and collagen fibers. This study supports the hypothesis that manual instrumentation alone or instrumentation combined with ultrasonic instrumentation is unable to remove the smear layer, whereas the subsequent topical application of EDTAC gel effectively removes the smear layer, uncovers dentinal openings and exposes collagen fibers.

Light and scanning electron microscopy of Henneguya arapaima n. sp (Myxozoa: Myxobolidae) and histology of infected sites in pirarucu (Arapaima gigas: Pisces: Arapaimidae) from the Araguaia River, Brazil

In this report, we describe Henneguya arapaima n. sp., a parasite of the gill arch and gall bladder of Arapaima gigas (pirarucu) collected in the Araguaia River, in the municipality of Nova Crixas, Goias State, central Brazil. The plasmodia were white, round or ellipsoidal and measured 200-600 mu m. Parasite development was asynchronous and the mature spores were fusifonn and had smooth wall. The spores measurements were (range, with means +/- S.D. in parentheses): total length-48.4-53.1 mu m (51.6 +/- 3.4 mu m), body length-13.5-15.2 mu m (14.2 +/- 0.8 mu m), body width-5.1-6.1 mu m (5.7 +/- 0.5 mu m), body thickness-4.7-5.3 mu m (4.9 +/- 0.2 mu m) and caudal process length-38.0-41.2 mu m (38.3 +/- 2.9 mu m). The polar capsules were elongated and of unequal size, with lengths of 6.3-6.8 mu m (6.5 +/- 0.2) and 6.2-6.6 mu m (6.3 +/- 0.1) for the longest and shortest axes, respectively. Capsule width was 1.4-1.6 mu m (1.5 +/- 0.1). Histological analysis showed that the plasmodia occurred in the tunica adventitia of the gall bladder and were delimited by a thin capsule of connective tissue. In the gill arch, the plasmodia were also surrounded by connective tissue similar to the endomesium, of striated skeletal muscle cells. Sixty-five juvenile specimens of A. gigas weighing 1.0-25.0 kg were examined, 17 (26.1%) of which were infected. Of these, 14 (82.3%) had cysts in the gall bladder, two (11.7%) had cysts in the gill arch and only one (5.9%) had cysts in both organs. When the fish were grouped by weight, the prevalence of infection in fish weighing up to 10.0 kg (20.7%) was significantly lower than in fish weighing 10.1-25.0 kg (50%) (G = 3.93; d.f. = 1; p < 0.05). (C) 2008 Elsevier B.V. All rights reserved.

A light and scanning electron microscopy study of bone healing following inferior alveolar nerve lateralization: An experimental study in rabbits

Purpose: The purpose of this study was to evaluate the bone healing kinetics around commercially pure titanium implants following inferior alveolar nerve (IAN) lateralization in a rabbit model. Materials and Methods: Inferior alveolar nerve lateralization was performed in 16 adult female rabbits (Oryctolagus cuniculus). During the nerve lateralization procedure, 1 implant was placed through the mandibular canal, and the IAN was replaced in direct contact with the implant. During the 8-week healing period, various bone labels were administered for fluorescent microscopy analysis. The animals were euthanized by anesthesia overdose, and the mandibular blocks were exposed by sharp dissection. Nondecalcified samples were prepared for optical light and scanning electron microscopy (SEM) evaluation. Results: SEM evaluation showed bone modeling/remodeling between the IAN and implant surface. Fluorochrome area fraction labeling at different times during the healing period showed that bone apposition mainly occurred during the first 2 weeks after implantation. Conclusions: The results obtained showed that bone healing/deposition occurred between the alveolar nerves in contact with a commercially pure titanium implant. No interaction between the nerve and the implant was detected after the 8-week healing period. Appositional bone healing occurred around the nerve bundle structure, restoring the mandibular canal integrity and morphology.