996 resultados para Variable frequency oscillators


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study analyzed the genotype distribution and frequency of lamivudine (LAM) and tenofovir (TDF) resistance mutations in a group of patients co-infected with HIV and hepatitis B virus (HBV). A cross-sectional study of 847 patients with HIV was conducted. Patients provided blood samples for HBsAg detection. The load of HBV was determined using an ""in-house"" real-time polymerase chain reaction. HBV genotypes/subgenotypes, antiviral resistance, basal core promoter (BCP), and precore mutations were detected by DNA sequencing. Twenty-eight patients with co-infection were identified. The distribution of HBV genotypes among these patients was A (n = 9; 50%), D (n = 4; 22.2%), G (n = 3; 16.7%), and F (n = 2; 11.1%). Eighteen patients were treated with LAM and six patients were treated with LAM plus TDF. The length of exposure to LAM and TDF varied from 4 to 216 months. LAM resistance substitutions (rtL180M + rtM204V) were detected in 10 (50%) of the 20 patients with viremia. This pattern and an accompanying rtV173L mutation was found in four patients. Three patients with the triple polymerase substitution pattern (rtV173L+ rtL180M + rtM204V) had associated changes in the envelope gene (sE164D + sl195M). Mutations in the BCP region (A1762T, G1764A) and in the precore region (G1896A, G1899A) were also found. No putative TDF resistance substitution was detected. The data suggest that prolonged LAM use is associated with the emergence of particular changes in the HBV genome, including substitutions that may elicit a vaccine escape phenotype. No putative TDF resistance change was detected after prolonged use of TDF. J. Med. Virol. 82:1481-1488, 2010. (C) 2010 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The technique of frequency-resolved optical gating is used to characterize the intensity and the phase of picosecond pulses after propagation through 700 m of fiber at close to the zero-dispersion wavelength. Using the frequency-resolved optical gating technique, we directly measure the severe temporal distortion resulting from the interplay between self-phase modulation and higher-order dispersion in this regime. The measured intensity and phase of the pulses after propagation are found to be in good agreement with the predictions of numerical simulations with the nonlinear Schrodinger equation. (C) 1997 Optical Society of America.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate risk factors for low bone mineral density (BMD) and vertebral fractures, in juvenile systemic lupus (JSLE). Thirty-one consecutive patients with JSLE were compared with 31 gender- and age-matched healthy controls. BNID and body composition from all participants were measured using dual-energy X-ray absorptiometry. Vertebral fractures were defined as a reduction of >= 20% of the vertebral height for all patients. Lumbar spine and total femur BMD was significantly decreased in patients compared with controls (P = 0.021 and P = 0.023, respectively). A high frequency of vertebral fractures (22.58%) was found in patients with JSLE. Analysis of body composition revealed lower lean mass (P = 0.033) and higher fat mass percentage (P = 0.003) in patients than in controls. Interestingly, multiple linear regression using BMD as a dependent variable showed a significant association with lean mass in lumbar spine (R(2) = 0.262; P = 0.004) and total femur (R(2) = 0.419, P = 0.0001), whereas no association was observed with menarche age, SLE Disease Activity Index, Systemic Lupus International Collaborating Clinics/American College of Rheumatology, and glucocorticoid. This study indicates that low BMD and vertebral fractures are common in JSLE, and the former is associated with low lean mass, suggesting that muscle rehabilitation may be an additional target for bone therapeutic approach.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

P>Background: Many patients with common variable immunodeficiency (CVID) have a clinical history suggestive of allergic respiratory disease. However, in such individuals, the prevalence of asthma and the role of atopy have not been well established. The objective of this study was to evaluate pulmonary function and identify asthma in patients with CVID. We also investigated the role of IgE as a trigger of asthma in these patients. Methods: Sixty-two patients diagnosed with CVID underwent spirometry, as well as skin prick testing and in vitro determination of serum-specific IgE levels for aeroallergens, together with bronchial provocation with histamine and allergen. Results: The most common alteration identified through spirometry was obstructive lung disease, which was observed in 29 (47.5%) of the 62 patients evaluated. Eighteen (29.0%) of the 62 patients had a clinical history suggestive of allergic asthma. By the end of the study, asthma had been diagnosed in nine (14.5%) patients and atopy had been identified in six (9.7%). In addition, allergic asthma had been diagnosed in four patients (6.5% of the sample as a whole; 22.2% of the 18 patients with a clinical history suggestive of the diagnosis). Conclusion: In this study, CVID patients testing negative for specific IgE antibodies and suspected of having allergic asthma presented a positive response to bronchial provocation tests with allergens. To our knowledge, this is the first such study. When CVID patients with a history suggestive of allergic asthma test negative on traditional tests, additional tests designed to identify allergic asthma might be conducted.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have designed, built, and tested an early prototype of a novel subxiphoid access system intended to facilitate epicardial electrophysiology, but with possible applications elsewhere in the body. The present version of the system consists of a commercially available insertion needle, a miniature pressure sensor and interconnect tubing, read-out electronics to monitor the pressures measured during the access procedure, and a host computer with user-interface software. The nominal resolution of the system is <0.1 mmHg, and it has deviations from linearity of <1%. During a pilot series of human clinical studies with this system, as well as in an auxiliary study done with an independent method, we observed that the pericardial space contained pressure-frequency components related to both the heart rate and respiratory rate, while the thorax contained components related only to the respiratory rate, a previously unobserved finding that could facilitate access to the pericardial space. We present and discuss the design principles, details of construction, and performance characteristics of this system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As nuclear magnetic resonance imaging and spectroscopy move inexorably toward higher field-strength magnets in search of improved signal-to-noise ratio, spectral resolution, and spatial resolution, the way in which radiofrequency (RF) probes are designed changes. At higher frequencies, resonant cavities become the favored RF ''coil'' type and may be built using streamline elements to reduce the inductance of the system. In modeling such systems, the quasi-static approach of assuming that current flows evenly in all conductor cross sections and that adjacent conductors do not affect each other becomes less reasonable. The proximity of RF conductors in resonators typically causes RF eddy currents to flow, whereby the current density in each rung is altered by the RF fields generated by nearby conductors. The proper understanding and prediction of how resonators will perform require a model of the current densities flowing in conducting sections, including all RF eddy current effects. Very few models of this type have been presented in the literature. This article presents an overview of one such model and of how it may be applied to a variety of resonators, both shielded and unshielded, circular, and elliptical, in cross section. Results are presented from a shielded head coil operating at 2 tesla. (C) 1997 John Wiley & Sons, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

H-1 NMR spectra of the thyroid hormone thyroxine recorded at low temperature and high field show splitting into two peaks of the resonance due to the H2,6 protons of the inner (tyrosyl) ring. A single resonance is observed in 600 MHz spectra at temperatures above 185 K. An analysis of the line shape as a function of temperature shows that the coalescence phenomenon is due to an exchange process with a barrier of 37 kJ mol(-1). This is identical to the barrier for coalescence of the H2',6' protons of the outer (phenolic) ring reported previously for the thyroid hormones and their analogues. It is proposed that the separate peaks at low temperature are due to resonances for H2,6 in cisoid and transoid conformers which are populated in approximately equal populations. These two peaks are averaged resonances for the individual H2 and H6 protons. Conversion of cisoid to transoid forms can occur via rotation of either the alanyl side chain or the outer ring, from one face of the inner ring to the other. It is proposed that the latter process is the one responsible for the observed coalescence phenomenon. The barrier to rotation of the alanyl side chain is greater than or equal to 37 kJ mol(-1), which is significantly larger than has previously been reported for Csp(2)-Csp(3) bonds in other Ph-CH2-X systems. The recent crystal structure of a hormone agonist bound to the ligand-binding domain of the rat thyroid hormone receptor (Wagner et al. Nature 1995, 378, 690-697) shows the transoid form to be the bound conformation. The significant energy barrier to cisoid/transoid interconversion determined in the current study combined with the tight fit of the hormone to its receptor suggests that interconversion between the forms cannot occur at the receptor site but that selection for the preferred bound form occurs from the 50% population of the transoid form in solution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Tetralogy of Fallot (TOF) is a congenital conotruncal heart defect commonly found in DiGeorge (DGS) and velocardiofacial (VCFS) syndromes. The deletion of chromosome 22q11 has also been demonstrated in sporadic or familial cases of TOF. The aim of the present study was to investigate the frequency of del22q11 in patients with non-syndromic TOF seen at a tertiary Pediatric Cardiology care center. Method: One hundred and twenty three non-syndromic TOF patients were selected and evaluated by history, physical examination and review of medical records. Venous blood was drawn for genomic DNA extraction after informed consent 22q11 microdeletion diagnosis was conducted through a standardized SNP genotyping assay and consecutive homozygosity mapping. Phenotype-genotype correlations regarding cardiac anatomy were conducted. Results: We evaluated 123 non-syndromic TOF patients for a 22q11 deletion. 105 (85.4%) patients presented pulmonary stenosis and 18 (14.6%) had pulmonary atresia. Eight patients (6.5%) were found to have a deletion. Of the deleted patients, three (37.5%) presented pulmonary atresia. We have verified a tendency towards a higher prevalence of pulmonary atresia when comparing TOF patients with and without 22q11 microdeletion. Conclusions: 22q11.2 deletion in non-syndromic TOF patients is present in approximately 6% of patients. We suggest a tendency towards a higher prevalence of pulmonary atresia in non-syndromic TOF patients with 22q11 microdeletion. Molecular genetic screening of non-syndromic TOF patient may be important for the correct care of these patients and a more specific genetic diagnostic and counseling. (C) 2007 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background-The use of corticosteroids in active Crohn's disease often becomes limited by side effects. Budesonide is a potent corticosteroid with low systemic bioavailability due to an extensive first pass liver metabolism. Aims-To compare the efficacy and safety of two dosage regimens of budesonide and prednisolone in patients with active Crohn's disease affecting the ileum and/or the ascending colon. Patients and methods-One hundred and seventy eight patients were randomised to receive budesonide controlled ileal release (CIR) capsules 9 mg once daily or 4.5 mg twice daily, or prednisolone tablets 40 mg once daily. The treatment period was 12 weeks. The primary efficacy variable was clinical remission, defined as a Crohn's Disease Activity Index (CDAI) of 150 or less. Results-After eight weeks of treatment, remission occurred in 60% of patients receiving budesonide once daily or prednisolone and in 42% of those receiving budesonide twice daily (p=0.062). The presence of glucocorticoid associated side effects was similar in all groups; however, moon face was more common in the prednisolone group (p=0.0005). The highest frequency of impaired adrenal function, as measured by a short ACTH test, was found in the prednisolone group (p=0.0023). Conclusions-Budesonide CIR, administered at 9 mg once daily or 4.5 mg twice daily, is comparable to prednisolone in inducing remission in active Crohn's disease. The single dose administration is as promptly effective as prednisolone and represents a simpler and safer therapeutic approach, with a considerable reduction in side effects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: Pancreas susceptibility to alcohol is variable and only 5-10% of chronic alcohol abusers develop chronic pancreatitis; the role of genetic factors in this process is unknown. The CFTR gene encodes a protein that acts on epithelial cells and plays a key role in normal exocrine pancreatic function. Methods: This study investigated the frequency of polymorphisms in intron 8 of the CFTR gene in patients with alcoholic chronic pancreatitis. Three groups of patients were studied: group A-68 adult alcoholics with a diagnosis of chronic pancreatitis; group B-68 adult alcoholics without pancreatic disease or liver cirrhosis and group C-104 healthy nonalcoholic adults. Results: T5/T7 genotype was more frequent in group A (11.8%) than in group B (2.9%) (p = 0.0481), and there was no statistical difference when groups A and C (5.8%) were compared (p = 0.1317). The haplotype combination (TG) 10-T7/(TG) 11-T7 was more frequent in groups B (23.5%) and C (20.2%) than in group A (7.3%) (p = 0.0080 and 0.0162). Conclusion: There are differences when these three groups are compared and individuals with T5/T7 genotype might have a greater risk of developing chronic pancreatitis when they become chronic alcoholics. Copyright (C) 2008 S. Karger AG, Basel and IAP

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Concurrent autoimmune disorders (CAIDs) have been shown to occur in 22% to 34% of the patients with autoimmune hepatitis (AIH). Their presence has been linked to female gender, older age, and to certain HLA antigens, namely HLA-A11. DRB1*04, and DRB4*01. Aims: To assess the frequency and nature of CAID in Brazilian patients with AIH types 1 (AIH-1) and 2 (AIH-2) and to investigate the influence of age, gender, and genetic background in their occurrence. Patients and Methods: The presence and nature of CAID was studied in 143 patients [117 females, median age 11 (1.3 to 69)] with AIH-1 (n = 125) and AIH-2 (n = 28). HLA typing and tumor necrosis factor a gene promoter and exon I cytotoxic T lymphocyte associated antigen 4 (CTLA-4) gene polymorphisms were determined by polymerase chain reaction-based techniques. Results: The frequency of CAID was similar in patients with AIH-1 (14%) and AIH-2 (18%), but their nature was shown to vary. Arthritis was seen in half of the patients (n = 8) with CAID and AIH-1 and in none of those with AIH-2. Subjects with AIH-1 and CAID were shown to be older [24 (1.3 to 6 1) vs. 11 (1.3 to 69) y P = 0.02] and to have more often circulating antinuclear antibody (76% vs. 40%, P = 0.008) and less frequently antiactin antibodies (33% vs. 75%, P = 0.008) when compared with their counterparts without CAID. No particular HLA-DR and DQ alleles, as well as tumor necrosis factor a and CTLA-4 genotypes, were associated with CAID. Conclusions: The nature, but not the frequency, of CAID was shown to vary in AIH-1 and AIH-2. In subjects with AIH-1, CAID was linked to older subjects and to the presence of antinuclear antibody. No predisposition to CAID was associated to HLA-DRB1*04 or DDB4*01 alleles. The observed lower frequency of CAID could be attributed to the lower age of disease onset in Brazilians and to differences in HLA-encoded susceptibility to AIH-1 observed in South America.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to separate the effects of experience from other characteristics of word frequency (e.g., orthographic distinctiveness), computer science and psychology students rated their experience with computer science technical items and nontechnical items from a wide range of word frequencies prior to being tested for recognition memory of the rated items. For nontechnical items, there was a curvilinear relationship between recognition accuracy and word frequency for both groups of students. The usual superiority of low-frequency words was demonstrated and high-frequency words were recognized least well. For technical items, a similar curvilinear relationship was evident for the psychology students, but for the computer science students, recognition accuracy was inversely related to word frequency. The ratings data showed that subjective experience rather than background word frequency was the better predictor of recognition accuracy.