Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prostatic acid phosphatase in serum and semen of dogs

The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The objective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.

Cryopreservation of bovine spermatozoa from the epididymal tail using conventional and automated methods

Cryopreservation of sperm is important to preserve the gerrnplasm from animals of genetic value, which can die unexpectedly. This study compares conventional and automated methods of cryopreservation of spermatozoa obtained from the epididymis of bulls post-mortem. Twenty-two epididymides were obtained from a commercial slaughterhouse. Spermatozoa were collected from the tail of the epididymis using the retrograde flow technique. Thus, the samples, which were diluted in 10 ml of extender without glycerol (Botubov (R) I, Botupharma, Botucatu, SP, Brazil), were evaluated on motility, sperm vigor, structural and functional (swelling hypoosmotic test) membrane integrity, mitochondrial activity, sperm viability and ADN fragmentation. The samples were divided into two aliquots and diluted in extender with glycerol (Botubov (R) II, Botupharma, Botucatu, SP, Brazil) at a concentration of 50x10(6) motile sperm/0.5 French straws. One sample was frozen by the conventional method (4 hours at 5 degrees C, in a refrigerator and 20 min in nitrogen vapor) and the other by the automated method (Cryogen (R) Dualflex, Neovet, Uberaba, MG, Brazil). The parameters were higher in all the tests of fresh sperm samples, with the exception of the swelling hypoosmotic test, which showed no significant difference when the results were compared with sperm frozen by the conventional method. The average motility of fresh spermatozoa was 74%, and conventional and automated averages were 29 and 25%, respectively. Therefore, although cryopreservation techniques reduce sperm quality parameters, the viability of the sperm is maintained, and these methods can be used to preserve sperm.

Isolate((R)) and Optiprep((R)) minigradients as alternatives for sperm selection in bovine in vitro embryo production

The objective of this study was to evaluate alternatives in small volumes to conventional gradient of Percoll((R)) on semen quality, in vitro embryo production, sex ratio and embryo survival after vitrification. Thawed semen was randomly allocated to one of four density gradient selection methods: (1) conventional Percoll((R)) (P), (2) MiniPercoll (MP), (3) MiniIsolate (MI), and (4) MiniOptiprep (MO). Sperm kinetics and quality were evaluated. Use of P, MP and MI gradients did not affect sperm motility (P > 0.05). However, there was a decrease in total and progressive sperm motility in MO (70.8 and 51.3% vs. 87.3 and 69.5% for P; 87.3 and 73% for MP; 92.3 and 78.8% for MI; P < 0.05). The MO had lower membrane integrity compared with P, MP and MI (39.7 vs. 70.5, 72.3, 63.8%, respectively, P < 0.05). The percentage of blastocysts produced was higher in MI than in MP and MO (21.1 vs. 16.1 and 16.9%, P < 0.05) and similar to P (18.4%; P > 0.05). Sex ratio and embryo survival after vitrification were similar among groups (P > 0.05). Semen selected by Isolate and Optiprep gradient, at the concentrations and small volumes used, demonstrated similar characteristics and in vitro embryo production to conventional Percoll((R)) gradient.

Semen characteristics of captive common marmoset (Callithrix jacchus): a comparison of a German with a Brazilian colony

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)