Liquid ultraviolet matrix-assisted laser desorption/ionization - mass spectrometry for automated proteomic analysis

We have combined several key sample preparation steps for the use of a liquid matrix system to provide high analytical sensitivity in automated ultraviolet -- matrix-assisted laser desorption/ionisation -- mass spectrometry (UV-MALDI-MS). This new sample preparation protocol employs a matrix-mixture which is based on the glycerol matrix-mixture described by Sze et al. The low-femtomole sensitivity that is achievable with this new preparation protocol enables proteomic analysis of protein digests comparable to solid-state matrix systems. For automated data acquisition and analysis, the MALDI performance of this liquid matrix surpasses the conventional solid-state MALDI matrices. Besides the inherent general advantages of liquid samples for automated sample preparation and data acquisition the use of the presented liquid matrix significantly reduces the extent of unspecific ion signals in peptide mass fingerprints compared to typically used solid matrices, such as 2,5-dihydroxybenzoic acid (DHB) or alpha-cyano-hydroxycinnamic acid (CHCA). In particular, matrix and low-mass ion signals and ion signals resulting from cation adduct formation are dramatically reduced. Consequently, the confidence level of protein identification by peptide mass mapping of in-solution and in-gel digests is generally higher.

MALDI MS

Matrix-assisted laser desorption/ionization (MALDI) is a key technique in mass spectrometry (MS)-based proteomics. MALDI MS is extremely sensitive, easy-to-apply, and relatively tolerant to contaminants. Its high-speed data acquisition and large-scale, off-line sample preparation has made it once again the focus for high-throughput proteomic analyses. These and other unique properties of MALDI offer new possibilities in applications such as rapid molecular profiling and imaging by MS. Proteomics and its employment in Systems Biology and other areas that require sensitive and high-throughput bioanalytical techniques greatly depend on these methodologies. This chapter provides a basic introduction to the MALDI methodology and its general application in proteomic research. It describes the basic MALDI sample preparation steps and two easy-to-follow examples for protein identification including extensive notes on these topics with practical tips that are often not available in the Subheadings 2 and 3 of research articles.

Liquid ultraviolet matrix-assisted laser desorption/ionization mass spectrometry for automated proteomic analysis

We have combined several key sample preparation steps for the use of a liquid matrix system to provide high analytical sensitivity in automated ultraviolet - matrix-assisted laser desorption/ ionisation - mass spectrometry (UV-MALDI-MS). This new sample preparation protocol employs a matrix-mixture which is based on the glycerol matrix-mixture described by Sze et al. U. Am. Soc. Mass Spectrom. 1998, 9, 166-174). The low-ferntomole sensitivity that is achievable with this new preparation protocol enables proteomic analysis of protein digests comparable to solid-state matrix systems. For automated data acquisition and analysis, the MALDI performance of this liquid matrix surpasses the conventional solid-state MALDI matrices. Besides the inherent general advantages of liquid samples for automated sample preparation and data acquisition the use of the presented liquid matrix significantly reduces the extent of unspecific ion signals in peptide mass fingerprints compared to typically used solid matrices, such as 2,5-dihydrox-ybenzoic acid (DHB) or alpha-cyano-hydroxycinnamic acid (CHCA). In particular, matrix and lowmass ion signals and ion signals resulting from cation adduct formation are dramatically reduced. Consequently, the confidence level of protein identification by peptide mass mapping of in-solution and in-gel digests is generally higher.

Analytical and compositional aspects of isoflavones in food and their biological effects

This paper provides an overview of analytical techniques used to determine isoflavones (IFs) in foods and biological fluids with main emphasis on sample preparation methods. Factors influencing the content of IFs in food including processing and natural variability are summarized and an insight into IF databases is given. Comparisons of dietary intake of IFs in Asian and Western populations, in special subgroups like vegetarians, vegans, and infants are made and our knowledge on their absorption, distribution, metabolism, and excretion by the human body is presented. The influences of the gut microflora, age, gender, background diet, food matrix, and the chemical nature of the IFs on the metabolism of IFs are described. Potential mechanisms by which IFs may exert their actions are reviewed, and genetic polymorphism as determinants of biological response to soy IFs is discussed. The effects of IFs on a range of health outcomes including atherosclerosis, breast, intestinal, and prostate cancers, menopausal symptoms, bone health, and cognition are reviewed on the basis of the available in vitro, in vivo animal and human data.

Molecular interactions between the penetration enhancer 1,8-cineole and human skin

Penetration enhancers are chemicals that temporarily and reversibly diminish the barrier function of the outermost layer of skin, the stratum corneum, to facilitate drug delivery to and through the tissue. In the current study, the complex mechanisms by which 1,8-cineole, a potent terpene penetration enhancer, disrupts the stratum corneum barrier is investigated using post-mortem skin samples. In order to validate the use of excised tissue for these and related studies, a fibre optical probe coupled to an FT-Raman spectrometer compared spectroscopic information for human skin recorded from in vivo and in vitro sampling arrangements. Spectra from full-thickness (epidermis and dermis) post-mortem skin samples presented to the spectrometer with minimal sample preparation (cold acetone rinse) were compared with the in vivo system (the forearms of human volunteers). No significant differences in the Raman spectra between the in vivo and in vitro samples were observed, endorsing the use of post-mortem or surgical samples for this investigational work. Treating post-mortem samples with the penetration enhancer revealed some unexpected findings: while evidence for enhancer-induced disruption of the barrier lipid packing in the stratum corneum was detected in some samples, spectra from other samples revealed an increase in lipid order on treatment with the permeation promoter. These findings are consistent with phase-separation of the enhancer within the barrier lipid domains as opposed to homogeneous disruption of the lipid lamellae. Copyright (C) 2006 John Wiley & Sons, Ltd.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Investigation of liquid MALDI and optimization for instrument tuning and quantitative measurements

The success of Matrix-assisted laser desorption / ionisation (MALDI) in fields such as proteomics has partially but not exclusively been due to the development of improved data acquisition and sample preparation techniques. This has been required to overcome some of the short comings of the commonly used solid-state MALDI matrices such as - cyano-4-hydroxycinnamic acid (CHCA) and 2,5-dihydroxybenzoic acid (DHB). Solid state matrices form crystalline samples with highly inhomogeneous topography and morphology which results in large fluctuations in analyte signal intensity from spot to spot and positions within the spot. This means that efficient tuning of the mass spectrometer can be impeded and the use of MALDI MS for quantitative measurements is severely impeded. Recently new MALDI liquid matrices have been introduced which promise to be an effective alternative to crystalline matrices. Generally the liquid matrices comprise either ionic liquid matrices (ILMs) or a usually viscous liquid matrix which is doped with a UV lightabsorbing chromophore [1-3]. The advantages are that the droplet surface is smooth and relatively uniform with the analyte homogeneously distributed within. They have the ability to replenish a sampling position between shots negating the need to search for sample hot-spots. Also the liquid nature of the matrix allows for the use of additional additives to change the environment to which the analyte is added.

Self-assembly and hydrogelation of an amyloid peptide fragment

The self-assembly of a fragment of the amyloid beta peptide that has been shown to be critical in amyloid fibrillization has been studied in aqueous solution. There are conflicting reports in the literature on the fibrillization of A beta (16-20), i.e., KLVFF, and our results shed light on this. In dilute solution, self-assembly of NH2-KLVFF-COOH is strongly influenced by aromatic interactions between phenylalanine units, as revealed by UV spectroscopy and circular dichroism. Fourier transform infrared (FTIR) spectroscopy reveals beta-sheet features in spectra taken for more concentrated solutions and also dried films. X-ray diffraction and cryo-transmission electron microscopy (cryo-TEM) provide further support for beta-sheet amyloid fibril formation. A comparison of cryo-TEM images with those from conventional dried and negatively stained TEM specimens highlights the pronounced effects of sample preparation on the morphology. A comparison of FTIR data for samples in solution and dried samples also highlights the strong effect of drying on the self-assembled structure. In more concentrated phosphate-buffered saline (PBS) solution, gelation of NH2-KLVFF-COOH is observed. This is believed to be caused by screening of the electrostatic charge on the peptide, which enables beta sheets to aggregate into a fibrillar gel network. The rheology of the hydrogel is probed, and the structure is investigated by light scattering and small-angle X-ray scattering.

Recommendations for the viability assessment of probiotics as concentrated cultures and in food matrices

Due to the fact that probiotic cells need to be alive when they are consumed, culture-based analysis (plate count) is critical in ascertaining the quality (numbers of viable cells) of probiotic products. Since probiotic cells are typically stressed, due to various factors related to their production, processing and formulation, the standard methodology for total plate counts tends to underestimate the cell numbers of these products. Furthermore, products such as microencapsulated cultures require modifications in the release and sampling procedure in order to correctly estimate viable counts. This review examines the enumeration of probiotic bacteria in the following commercial products: powders, microencapsulated cultures, frozen concentrates, capsules, foods and beverages. The parameters which are specifically examined include: sample preparation (rehydration, thawing), dilutions (homogenization, media) and plating (media, incubation) procedures. Recommendations are provided for each of these analytical steps to improve the accuracy of the analysis. Although the recommendations specifically target the analysis of probiotics, many will apply to the analysis of commercial lactic starter cultures used in food fermentations as well.

Structurally-related (−)-epicatechin metabolites in humans: assessment using de novo chemically synthesized authentic standards

Accumulating data suggest that diets rich in flavanols and procyanidins are beneficial for human health. In this context, there has been a great interest in elucidating the systemic levels and metabolic profiles at which these compounds occur in humans. While recent progress has been made, there still exist considerable differences and various disagreements with regard to the mammalian metabolites of these compounds, which in turn is largely a consequence of the lack of availability of authentic standards that would allow for the directed development and validation of expedient analytical methodologies. In the present study, we developed a method for the analysis of structurally-related flavanol metabolites using a wide range of authentic standards. Applying this method in the context of a human dietary intervention study using comprehensively characterized and standardized flavanol- and procyanidin-containing cocoa, we were able to identify the structurally-related (−)-epicatechin metabolites (SREM) postprandially extant in the systemic circulation of humans. Our results demonstrate that (−)-epicatechin-3′-β-D-glucuronide, (−)-epicatechin-3′-sulfate, and a 3′-O-methyl(−)-epicatechin-5/7-sulfate are the predominant SREM in humans, and further confirm the relevance of the stereochemical configuration in the context of flavanol metabolism. In addition, we also identified plausible causes for the previously reported discrepancies regarding flavanol metabolism, consisting to a significant extent of inter-laboratory differences in sample preparation (enzymatic treatment and sample conditioning for HPLC analysis) and detection systems. Thus, these findings may also aid in the establishment of consensus on this topic.

Accurate analysis of noble gas concentrations in small water samples and its application to fluid inclusions in stalagmites

The concentrations of dissolved noble gases in water are widely used as a climate proxy to determine noble gas temperatures (NGTs); i.e., the temperature of the water when gas exchange last occurred. In this paper we make a step forward to apply this principle to fluid inclusions in stalagmites in order to reconstruct the cave temperature prevailing at the time when the inclusion was formed. We present an analytical protocol that allows us accurately to determine noble gas concentrations and isotope ratios in stalagmites, and which includes a precise manometrical determination of the mass of water liberated from fluid inclusions. Most important for NGT determination is to reduce the amount of noble gases liberated from air inclusions, as they mask the temperature-dependent noble gas signal from the water inclusions. We demonstrate that offline pre-crushing in air to subsequently extract noble gases and water from the samples by heating is appropriate to separate gases released from air and water inclusions. Although a large fraction of recent samples analysed by this technique yields NGTs close to present-day cave temperatures, the interpretation of measured noble gas concentrations in terms of NGTs is not yet feasible using the available least squares fitting models. This is because the noble gas concentrations in stalagmites are not only composed of the two components air and air saturated water (ASW), which these models are able to account for. The observed enrichments in heavy noble gases are interpreted as being due to adsorption during sample preparation in air, whereas the excess in He and Ne is interpreted as an additional noble gas component that is bound in voids in the crystallographic structure of the calcite crystals. As a consequence of our study's findings, NGTs will have to be determined in the future using the concentrations of Ar, Kr and Xe only. This needs to be achieved by further optimizing the sample preparation to minimize atmospheric contamination and to further reduce the amount of noble gases released from air inclusions.

Liquid AP-UV-MALDI enables stable ion yields of multiply charged peptide and protein ions for sensitive analysis by mass spectrometry

In biological mass spectrometry (MS), two ionization techniques are predominantly employed for the analysis of larger biomolecules, such as polypeptides. These are nano-electrospray ionization [1, 2] (nanoESI) and matrix-assisted laser desorption/ionization [3, 4] (MALDI). Both techniques are considered to be “soft”, allowing the desorption and ionization of intact molecular analyte species and thus their successful mass-spectrometric analysis. One of the main differences between these two ionization techniques lies in their ability to produce multiply charged ions. MALDI typically generates singly charged peptide ions whereas nanoESI easily provides multiply charged ions, even for peptides as low as 1000 Da in mass. The production of highly charged ions is desirable as this allows the use of mass analyzers, such as ion traps (including orbitraps) and hybrid quadrupole instruments, which typically offer only a limited m/z range (< 2000–4000). It also enables more informative fragmentation spectra using techniques such as collisioninduced dissociation (CID) and electron capture/transfer dissociation (ECD/ETD) in combination with tandem MS (MS/MS). [5, 6] Thus, there is a clear advantage of using ESI in research areas where peptide sequencing, or in general, the structural elucidation of biomolecules by MS/MS is required. Nonetheless, MALDI with its higher tolerance to contaminants and additives, ease-of-operation, potential for highspeed and automated sample preparation and analysis as well as its MS imaging capabilities makes it an ionization technique that can cover bioanalytical areas for which ESI is less suitable. [7, 8] If these strengths could be combined with the analytical power of multiply charged ions, new instrumental configurations and large-scale proteomic analyses based on MALDI MS(/MS) would become feasible.

MALDI mass spectrometry in prostate cancer biomarker discovery

Matrix-assisted laser desorption/ionisation (MALDI) mass spectrometry (MS) is a highly versatile and sensitive analytical technique, which is known for its soft ionisation of biomolecules such as peptides and proteins. Generally, MALDI MS analysis requires little sample preparation, and in some cases like MS profiling it can be automated through the use of robotic liquid-handling systems. For more than a decade now, MALDI MS has been extensively utilised in the search for biomarkers that could aid clinicians in diagnosis, prognosis, and treatment decision making. This review examines the various MALDI-based MS techniques like MS imaging, MS profiling and proteomics in-depth analysis where MALDI MS follows fractionation and separation methods such as gel electrophoresis, and how these have contributed to prostate cancer biomarker research. This article is part of a Special Issue entitled: Biomarkers: A Proteomic Challenge.