993 resultados para S-PROCESS-RICH
Resumo:
The effect of pore structure on the behavior of lithium intercalation into an electrode containing porous V(2)O(5) film has been investigated and compared with the electrode containing a non-porous V(2)O(5) film. X-ray diffraction patterns indicate a lamellar structure for both materials. Nitrogen adsorption isotherms, t-plot method, and Scanning Electronic Microscopy show that the route employed for the preparation of mesoporous V(2)O(5) was successful. The electrochemical performance of these matrices as lithium intercalation cathode materials was evaluated. The porous material reaches stability after several cycles more easily compared with the V(2)O(5) xerogel. Lithium intercalation into the porous V(2)O(5) film electrode is crucially influenced by pore surface and film surface irregularity, in contrast with the non-porous surface of the V(2)O(5) xerogel.
Resumo:
Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.
Resumo:
This study presents the possibilities offered by microfluidic structures for the production of polymeric microspheres, using a process based upon the production of an emulsion. LTCC (Low Temperature Co-fired Ceramics) micromixers have been used for the preparation of polymeric microspheres. The effect of the geometry of the micromixers has been studied, with a specific focus on the size of the microspheres. as well as the control release properties of a model protein loaded within these microspheres. (C) 2008 Published by Elsevier B.V.
Resumo:
The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.
Resumo:
An important consideration in the development of mathematical models for dynamic simulation, is the identification of the appropriate mathematical structure. By building models with an efficient structure which is devoid of redundancy, it is possible to create simple, accurate and functional models. This leads not only to efficient simulation, but to a deeper understanding of the important dynamic relationships within the process. In this paper, a method is proposed for systematic model development for startup and shutdown simulation which is based on the identification of the essential process structure. The key tool in this analysis is the method of nonlinear perturbations for structural identification and model reduction. Starting from a detailed mathematical process description both singular and regular structural perturbations are detected. These techniques are then used to give insight into the system structure and where appropriate to eliminate superfluous model equations or reduce them to other forms. This process retains the ability to interpret the reduced order model in terms of the physico-chemical phenomena. Using this model reduction technique it is possible to attribute observable dynamics to particular unit operations within the process. This relationship then highlights the unit operations which must be accurately modelled in order to develop a robust plant model. The technique generates detailed insight into the dynamic structure of the models providing a basis for system re-design and dynamic analysis. The technique is illustrated on the modelling for an evaporator startup. Copyright (C) 1996 Elsevier Science Ltd
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.
Resumo:
Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.
Resumo:
The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.
Resumo:
In order to analyse the effect of modelling assumptions in a formal, rigorous way, a syntax of modelling assumptions has been defined. The syntax of modelling assumptions enables us to represent modelling assumptions as transformations acting on the set of model equations. The notion of syntactical correctness and semantical consistency of sets of modelling assumptions is defined and methods for checking them are described. It is shown on a simple example how different modelling assumptions act on the model equations and their effect on the differential index of the resulted model is also indicated.
Resumo:
Background/Aim: Galectin-3 has been associated with activated Wnt pathway, translocating beta-catenin into the nucleus. However, it is still unknown whether this lectin drives the Wnt signaling activation in lesions from galectin-3-deficient (Gal3(-/-)) mice. The purpose was to study beta-catenin expression in tongue lesions from Gal3(-/-) and wildtype (Gal3(+/+)) mice and the status of Wnt signaling. Materials and Methods: Twenty Gal3(-/-) and Gal3(+/+) male mice were challenged with 4-nitroquinolin-1-oxide and killed at week 16 and 32. Tongues were processed and stained with H&E to detect dysplasias and carcinomas. An imunohistochemical assay was performed to evaluate beta-catenin expression. Results: Carcinomas were more evident in Gal3(+/+) than Gal3(-/-) mice (55.5% vs. 28.5%, respectively; p>0.05). Elevated expression of non-membranous beta-catenin was observed in dysplasias and carcinomas from both groups (p>0.05). Conclusion: Absence of galectin-3 does not interfere in the pattern of beta-catenin expression and therefore in the mediation of the Wnt signaling pathway.
Resumo:
This study aimed at verifying the effects of phonophoresis associated with Arnica montana on the acute phase of an inflammatory muscle lesion. Forty Wistar male rats (300 +/- 50 g), of which the Tibialis Anterior muscle was surgically lesioned, were divided into four groups (n = 10 each): control group received no treatment; the ultrasound group (US) was treated in pulsed mode with 1-MHz frequency, 0.5 W/cm(2) intensity (spatial and temporal average - SATA), duty cycle of 1: 2 (2 ms on, 4 ms off, 50%), time of application 3 min per session, one session per day, for 3 days; the phonophoresis or ultrasound plus arnica (US+A) group was treated with arnica with the same US parameters plus arnica gel; and the arnica group (A) was submitted to massage with arnica gel, also for 3 min, once a day, for 3 days. Treatment started 24 h after the surgical lesion. On the 4th day after lesion creation, animals were sacrificed and sections of the lesioned, inflamed muscle were removed for quantitative (mononuclear and polymorphonuclear cell count) and qualitative histological analysis. Collected data from the 4 groups were statistically analyzed and the significance level set at p < 0.05. Results show higher mononuclear cell density in all three treated groups with no significant difference between them, but values were significantly different (p < 0.0001) when compared to control group`s. As to polymorphonuclear cell density, significant differences were found between control group (p = 0.0134) and US, US+A and A groups; the arnica group presented lesser density of polymorphonuclear cells when compared (p = 0.0134) to the other groups. No significant difference was found between US and US+A groups. While the massage with arnica gel proved to be an effective anti-inflammatory on acute muscle lesion in topic use, these results point to ineffectiveness of Arnica montana phonophoresis, US having seemingly checked or minimized its anti-inflammatory effect. (C) 2008 Elsevier B. V. All rights reserved.
Resumo:
A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.