981 resultados para Regulatory Elements


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The DAN/TIR mannoprotein genes of Saccharomyces cerevisiae (DAN1, DAN2, DAN3, DAN4, TIR1, TIR2, TIR3 and TIR4) are expressed in anaerobic cells while the predominant cell wall proteins Cwp1 and Cwp2 are down-regulated. Elements involved in activation and repression of the DAN/TIR genes were defined in this study, using the DAN1 promoter as a model. Nested deletions in a DAN1/lacZ reporter pinpointed regions carrying activation and repression elements. Inspection revealed two consensus sequences subsequently shown to be independent anaerobic response elements (AR1, consensus TCGTTYAG; AR2, consensus AAAAATTGTTGA). AR1 is found in all of the DAN/TIR promoters; AR2 is found in DAN1, DAN2 and DAN3. A 120 bp segment carrying two copies of AR1 preferentially activated transcription of lacZ under anaerobic conditions. A fusion of three synthetic copies of AR1 to MEL1 was also expressed anaerobically. Mutations in either AR1 site within the 120 bp segment caused a drastic loss of expression, indicating that both are necessary for activation and implying cooperativity between adjacent transcriptional activation complexes. A single AR2 site carried on a 46 bp fragment from the DAN1 promoter activated lacZ transcription under anaerobic conditions, as did a 26 bp synthetic AR2 fragment fused to MEL1. Nucleotide substitutions within the AR2 sequence eliminated the activity of the 46 bp segment. Ablation of the AR2 sequences in the full promoter caused a partial reduction of expression. The presence of the ATTGTT core (recognized by HMG proteins) in the AR2 sequence suggests that an HMG protein may activate through AR2. One region was implicated in aerobic repression of DAN1. It contains sites for the heme-induced Mot3 and Rox1 repressors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have used a transgene mutation approach to study how expression domains of Hoxc8 are established during mouse embryogenesis. A cis-regulatory region located 3 kb upstream from the Hoxc8 translational start site directs the early phase of expression. Four elements, termed A, B, C, and D, were previously shown to direct expression to the neural tube. Here we report that a fifth element, E, located immediately downstream of D directs expression to mesoderm in combination with the other four elements. These elements are interdependent and partially redundant. Different combinations of elements determine expression in different posterior regions of the embryo. Neural tube expression is determined minimally by ABC, ABD, or ACD; somite expression by ACDE; and lateral plate mesoderm expression by DE. Neural tube and lateral plate mesoderm enhancers can be separated, but independent somite expression has not been achieved. Furthermore, mutations within these elements result in posteriorization of the reporter gene expression. Thus, the anterior extent of expression is determined by the combined action of these elements. We propose that the early phase of Hoxc8 expression is directed by two separate mechanisms: one that determines tissue specificity and another that determines anterior extent of expression.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

p53 is a multifunctional tumor suppressor protein involved in the negative control of cell growth. Mutations in p53 cause alterations in cellular phenotype, including immortalization, neoplastic transformation, and resistance to DNA-damaging drugs. To help dissect distinct functions of p53, a set of genetic suppressor elements (GSEs) capable of inducing different p53-related phenotypes in rodent embryo fibroblasts was isolated from a retroviral library of random rat p53 cDNA fragments. All the GSEs were 100-300 nucleotides long and were in the sense orientation. They fell into four classes, corresponding to the transactivator (class I), DNA-binding (class II), and C-terminal (class III) domains of the protein and the 3'-untranslated region of the mRNA (class IV). GSEs in all four classes promoted immortalization of primary cells, but only members of classes I and III cooperated with activated ras to transform cells, and only members of class III conferred resistance to etoposide and strongly inhibited transcriptional transactivation by p53. These observations suggest that processes related to control of senescence, response to DNA damage, and transformation involve different functions of the p53 protein and furthermore indicate a regulatory role for the 3'-untranslated region of p53 mRNA.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cytoplasmic polyadenylylation is an evolutionarily conserved mechanism involved in the translational activation of a set of maternal messenger RNAs (mRNAs) during early development. In this report, we show by interspecies injections that Xenopus and mouse use the same regulatory sequences to control cytoplasmic poly(A) addition during meiotic maturation. Similarly, Xenopus and Drosophila embryos exploit functionally conserved signals to regulate polyadenylylation during early post-fertilization development. These experiments demonstrate that the sequence elements that govern cytoplasmic polyadenylylation, and hence one form of translational activation, function across species. We infer that the requisite regulatory sequence elements, and likely the trans-acting components with which they interact, have been conserved since the divergence of vertebrates and arthropods.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

As an essential nutrient and a potential toxin, iron poses an exquisite regulatory problem in biology and medicine. At the cellular level, the basic molecular framework for the regulation of iron uptake, storage, and utilization has been defined. Two cytoplasmic RNA-binding proteins, iron-regulatory protein-1 (IRP-1) and IRP-2, respond to changes in cellular iron availability and coordinate the expression of mRNAs that harbor IRP-binding sites, iron-responsive elements (IREs). Nitric oxide (NO) and oxidative stress in the form of H2O2 also signal to IRPs and thereby influence cellular iron metabolism. The recent discovery of two IRE-regulated mRNAs encoding enzymes of the mitochondrial citric acid cycle may represent the beginnings of elucidating regulatory coupling between iron and energy metabolism. In addition to providing insights into the regulation of iron metabolism and its connections with other cellular pathways, the IRE/IRP system has emerged as a prime example for the understanding of translational regulation and mRNA stability control. Finally, IRP-1 has highlighted an unexpected role for iron sulfur clusters as post-translational regulatory switches.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The herpes simplex virus 1 infected cell protein 4 (ICP4) binds to DNA and regulates gene expression both positively and negatively. EAP (Epstein-Barr virus-encoded small nuclear RNA-associated protein) binds to small nonpolyadenylylated nuclear RNAs and is found in nucleoli and in ribosomes, where it is also known as L22. We report that EAP interacts with a domain of ICP4 that is known to bind viral DNA response elements and transcriptional factors. In a gel-shift assay, a glutathione S-transferase (GST)-EAP fusion protein disrupted the binding of ICP4 to its cognate site on DNA in a dose-dependent manner. This effect appeared to be specifically due to EAP binding to ICP4 because (i) GST alone did not alter the binding of ICP4 to DNA, (ii) GST-EAP did not bind to the probe DNA, and (iii) GST-EAP did not influence the binding of the alpha gene trans-inducing factor (alphaTIF or VP16) to its DNA cognate site. Early in infection, ICP4 was dispersed throughout the nucleoplasm, whereas EAP was localized to the nucleoli. Late in infection, EAP was translocated from nucleoli and colocalized with ICP4 in small, dense nuclear structures. The formation of dense structures and the colocalization of EAP and ICP4 did not occur if virus DNA synthesis and late gene expression were prevented by the infection of cells at the nonpermissive temperature with a mutant virus defective in DNA synthesis, or in cells infected and maintained in the presence of phosphonoacetate, which is an inhibitor of viral DNA synthesis. These results suggest that the translocation of EAP from the nucleolus to the nucleoplasm is a viral function and that EAP plays a role in the regulatory functions expressed by ICP4.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The posttranscriptional control of iron uptake, storage, and utilization by iron-responsive elements (IREs) and iron regulatory proteins (IRPs) provides a molecular framework for the regulation of iron homeostasis in many animals. We have identified and characterized IREs in the mRNAs for two different mitochondrial citric acid cycle enzymes. Drosophila melanogaster IRP binds to an IRE in the 5' untranslated region of the mRNA encoding the iron-sulfur protein (Ip) subunit of succinate dehydrogenase (SDH). This interaction is developmentally regulated during Drosophila embryogenesis. In a cell-free translation system, recombinant IRP-1 imposes highly specific translational repression on a reporter mRNA bearing the SDH IRE, and the translation of SDH-Ip mRNA is iron regulated in D. melanogaster Schneider cells. In mammals, an IRE was identified in the 5' untranslated regions of mitochondrial aconitase mRNAs from two species. Recombinant IRP-1 represses aconitase synthesis with similar efficiency as ferritin IRE-controlled translation. The interaction between mammalian IRPs and the aconitase IRE is regulated by iron, nitric oxide, and oxidative stress (H2O2), indicating that these three signals can control the expression of mitochondrial aconitase mRNA. Our results identify a regulatory link between energy and iron metabolism in vertebrates and invertebrates, and suggest biological functions for the IRE/IRP regulatory system in addition to the maintenance of iron homeostasis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Posttranscriptional regulation of genes of mammalian iron metabolism is mediated by the interaction of iron regulatory proteins (IRPs) with RNA stem-loop sequence elements known as iron-responsive elements (IREs). There are two identified IRPs, IRP1 and IRP2, each of which binds consensus IREs present in eukaryotic transcripts with equal affinity. Site-directed mutagenesis of IRP1 and IRP2 reveals that, although the binding affinities for consensus IREs are indistinguishable, the contributions of arginine residues in the active-site cleft to the binding affinity are different in the two RNA binding sites. Furthermore, although each IRP binds the consensus IRE with high affinity, each IRP also binds a unique alternative ligand, which was identified in an in vitro systematic evolution of ligands by exponential enrichment procedure. Differences in the two binding sites may be important in the function of the IRE-IRP regulatory system.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Several families of putative transposable elements (TrEs) in both solanaceous plants and Caenorhabditis elegans have been identified by screening the DNA data base for inverted repeated domains present in multiple copies in the genome. The elements are localized within intron and flanking regions of many genes. These elements consist of two inverted repeats flanking sequences ranging from 5 bp to > 500 bp. Identification of multiple elements in which sequence conservation includes both the flanking and internal regions implies that these TrEs are capable of duplicative transposition. Two of the elements were identified in promoter regions of the tomato (Lycoperiscon esculentum) polygalacturonase and potato (Solanum tuberosum) Win1 genes. The element in the polygalacturonase promoter spans a known regulatory region. In both cases, ancestral DNA sequences, which represent potential recombination target sequences prior to insertion of the elements, have been cloned from related species. The sequences of the inverted repeated domains in plants and C. elegans show a high degree of phylogenetic conservation. While frequency of the different elements is variable, some are present in very high copy number. A member of a single C. elegans TrE family is observed approximately once every 20 kb in the genome. The abundance of the described TrEs suggests utility in the genomic analysis of these and related organisms.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

One of the important themes in the new institutionalism is the convergence of market regulations in a world with three powerful clusters of countries (Western Europe, North America, and East Asia) on a small number of regimes, like disorganized capitalism, free market capitalism, and coordinated market capitalism. This paper examines the political-economic theory of regulatory convergence. It reconstructs and compares three welfarist approaches: the optimal regulatory regime (Tinbergen), the rule of constitutional law (Buchanan), and regulatory rivalry (Hayek). The paper concludes that most plausible results of convergence theory are completely opposite to the expressed political intentions of the theorists. Tinbergen's theory predicts neoliberalism, not social democracy. The theories of Buchanan and Hayek predict respectively a consensual or spontaneous formation of corporatist regulations, not the return of classical constitutionalism or liberalism. The paper summons new institutionalists to repair the weak scientific elements of convergence theory and to make a distinction between the ideological origins of this theory and its unintended ideological consequences.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Hox genes encode transcription factors that regulate morphogenesis in all animals with bilateral symmetry. Although Hox genes have been extensively studied, their molecular function is not clear in vertebrates, and only a limited number of genes regulated by Hox transcription factors have been identified. Hoxa2 is required for correct development of the second branchial arch, its major domain of expression. We now show that Meox1 is genetically downstream from Hoxa2 and is a direct target. Meox1 expression is downregulated in the second arch of Hoxa2 mouse mutant embryos. In chromatin immunoprecipitation (ChIP), Hoxa2 binds to the Meox1 proximal promoter. Two highly conserved binding sites contained in this sequence are required for Hoxa2-dependent activation of the Meox1 promoter. Remarkably, in the absence of Meox1 and its close homolog Meox2, the second branchial arch develops abnormally and two of the three skeletal elements patterned by Hoxa2 are malformed. Finally, we show that Meox1 can specifically bind the DNA sequences recognized by Hoxa2 on its functional target genes. These results provide new insight into the Hoxa2 regulatory network that controls branchial arch identity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The function of the prion protein gene (PRNP) and its normal product PrPC is elusive. We used comparative genomics as a strategy to understand the normal function of PRNP. As the reliability of comparisons increases with the number of species and increased evolutionary distance, we isolated and sequenced a 66.5 kb BAC containing the PRNP gene from a distantly related mammal, the model Australian marsupial Macropus eugenii (tammar wallaby). Marsupials are separated from eutherians such as human and mouse by roughly 180 million years of independent evolution. We found that tammar PRNP, like human PRNP, has two exons. Prion proteins encoded by the tammar wallaby and a distantly related marsupial, Monodelphis domestica (Brazilian opossum) PRNP contain proximal PrP repeats with a distinct, marsupial-specific composition and a variable number. Comparisons of tammar wallaby PRNP with PRNPs from human, mouse, bovine and ovine allowed us to identify non-coding gene regions conserved across the marsupial-eutherian evolutionary distance, which are candidates for regulatory regions. In the PRNP 3' UTR we found a conserved signal for nuclear-specific polyadenylation and the putative cytoplasmic polyadenylation element (CPE), indicating that post-transcriptional control of PRNP mRNA activity is important. Phylogenetic footprinting revealed conserved potential binding sites for the MZF-1 transcription factor in both upstream promoter and intron/intron 1, and for the MEF2, MyTI, Oct-1 and NFAT transcription factors in the intron(s). The presence of a conserved NFAT-binding site and CPE indicates involvement of PrPC in signal transduction and synaptic plasticity. (c) 2004 Elsevier B.V. All rights reserved.