Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Effect of hyperbaric oxygenation on mitochondrial function of neuronal cells in the cortex of neonatal rats after hypoxic-ischemic brain damage

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Oxidative enzymes activity in sugarcane juice as a function of the planting system

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Thermodynamic properties of water sorption of jackfruit (Artocarpus heterophyllus Lam.) as a function of moisture content

The Jackfruit tree is one of the most significant trees in tropical home gardens and perhaps the most widespread and useful tree in the important genus Artocarpus. The fruit is susceptible to mechanical and biological damage in the mature state, and some people find the aroma of the fruit objectionable, particularly in confined spaces. The dehydration process could be an alternative for the exploitation of this product, and the relationship between moisture content and water activity provides useful information for its processing and storage. The aim of this study was to determine the thermodynamic properties of the water sorption of jackfruit (Artocarpus heterophyllus Lam.) as a function of moisture content. Desorption isotherms of the different parts of the jackfruit (pulp, peduncle, mesocarp, peel, and seed) were determined at four different temperatures (313.15, 323.15, 333.15, and 343.15 K) in a water activity range of 0.02-0.753 using the static gravimetric method. Theoretical and empirical models were used to model the desorption isotherms. An analytical solution of the Clausius-Clapeyron equation was proposed to calculate the isosteric heat of sorption, the differential entropy, and Gibbs' free energy using the Guggenhein-Anderson-de Boer and Oswin models considering the effect of temperature on the hygroscopic equilibrium.

Incidence of green soybean seeds as a function of environmental stresses during seed maturation

Hot and dry weather conditions during soybean [Glycine max (L.) Merrill] seed maturation can cause forced maturation of the seed, resulting in the production of high levels of green seed, which may be detrimental to seed germination. These stressful conditions were imposed on soybean plants during seed maturation to investigate the production of green seeds and seed quality. Plants of the CD 206 cultivar were grown in a greenhouse until the R5.5 growing stage and then transferred to phytotrons at R6 and R7.2 for stress induction. Plants were subjected to two temperature regimes, high (28ºC to 36ºC) and normal (19ºC to 26ºC), and four soil water availability conditions, control (adequate water supply), 30% gravimetric moisture (GM), 20% GM and no water supply. Seed were harvested at R9. Green seed percentages and 100-seed weights from the lower, middle and upper thirds of each plant were determined. Seed quality was assessed by germination, tetrazolium (viability and vigor) and electrical conductivity tests. Occurrence of green seed varied from 9% to 86%, depending on the severity of the stresses imposed. High temperature, coupled with no water supply at R6, resulted in a pronounced occurrence of green seeds. There was no difference in the percentage of green seeds among the plant segments. Seed quality was negatively affected by the incidence of green seeds. A procedure for screening soybean genotypes in a phytotron for their tolerance and/or susceptibility to the production of green seeds was developed.

Evaluation of the Efficiency of Line-Start Permanent-Magnet Machines as a Function of the Operating Temperature

The standard squirrel-cage induction machine has nearly reached its maximum efficiency. In order to further increase the energy efficiency of electrical machines, the use of permanent magnets in combination with the robust design and the line start capability of the induction machine is extensively investigated. Many experimental designs have been suggested in literature, but recently, these line-start permanent-magnet machines (LSPMMs) have become off-the-shelf products available in a power range up to 7.5 kW. The permanent magnet flux density is a function of the operating temperature. Consequently, the temperature will affect almost every electrical quantity of the machine, including current, torque, and efficiency. In this paper, the efficiency of an off-the-shelf 4-kW three-phase LSPMM is evaluated as a function of the temperature by both finite-element modeling and by practical measurements. In order to obtain stator, rotor, and permanent magnet temperatures, lumped thermal modeling is used.

"I like my beer cold, my TV loud, and my homosexuals flaming!" : preference for stereotype consistency as a function of a person x situation interaction /

The study centers on the power of Right-Wing Authoritarianism (RWA) and Social Dominance Orientation (SDO) as predictors of prejudice against stereotypical and nonstereotypical homosexuals under the threat of death and the threat of uncertainty. Right-wing authoritarianism (RWA) is an individual difference variable that measures the tendency for individuals to unquestionably follow those perceived to be authorities. Social Dominance Orientation (SDO) is an individual difference variable that measures the degree to which an individual prefers inequality among social groups. The RWA and SDO Scales are considered to be two of the strongest predictors of prejudice, such as prejudice against homosexuals. The study focuses on the unique predictive power of these two variables in predicting prejudice against homosexuals. The study also examines the role of situational threat in prejudice, specifically the threat of death (mortality salience) and the threat of uncertainty (uncertainty salience). Competing predictions from theories involving the threat of death (Terror Management Theory) and the threat of uncertainty (Uncertainty Management Theory) are also tested. The preference for expected information in the form of stereotypes concerning male homosexuals (that is, a stereotypical or non-stereotypical homosexual) were tested. The difference between the predictive power ofRWA and SDO was examined by measuring how these variables predict liking of a stereotypical or non-stereotypical homosexual under the threat of death, the threat of uncertainty, or a control condition. Along with completing a measure for RWA and a measure for SDO, participants were asked to think of their own death, of their being uncertain or about watching television then were asked to read about a week in the life of either a stereotypical or non-stereotypical male homosexual. Participants were then asked to evaluate the individual and his essay. Based on the participants' evaluations, results from 180 heterosexual university students show that RWA and SDO are strong predictors for disliking of a stereotypical homosexual under the threat of uncertainty and disliking of a non-stereotypical homosexual under the threat of death. Furthermore, however, results show that RWA is a particularly strong predictor of disliking of a stereotypical homosexual under the threat of uncertainty, whereas SDO is an exceptionally strong predictor of disliking of the non-stereotypical homosexual under the threat of death. This further adds to the notion that RWA and SDO are indeed unique predictors of prejudice. Implications are also explored, including the fact that the study simuhaneously examined the role of individual difference variables and situational threat variables, as well as exploratory analysis on Dominating Authoritarians.

Expression and function of endothelin and its receptors in vascular adventitial fibroblasts

Objective: The adventitia has been recognized to play important roles in vascular oxidative stress, remodelling and contraction. We recently demonstrated that adventitial fibroblasts are able to express endothelin-1 (ET-1) in response to angiotensin II (ANG II). However, the mechanisms by which ANG II induces ET-1 expression are unknown. It is also unclear whether the ET-1 receptors are expressed in the adventitia. We therefore examined the role of oxidative stress in the regulation of ET-1. We also investigated the expression of both the ETA and ETB receptors and the roles of these two types of receptors in collagen synthesis and ET-1 clearance in adventitial fibroblasts. Methods and Results: Adventitial fibroblasts were isolated and cultured from the thoracic mouse aorta. Cells were treated with ANG II (lOOnM), ET-1 (lOpM), NADPH oxidase inhibitor apocynin (lOOfiM), the superoxide anion scavenger tempol (lOOfiM), the ANG II receptor antagonists (100[aM), losartan (AT| receptor) and PD 1233 19 (AT2 receptor), the ET-1 receptor antagonists (lOOuM), BQ123 (ETA receptor) and BQ788 (ETB receptor), and the ETB receptor agonist (lOOnM) Sarafotoxin 6C. ET-1 peptide levels were determined by ELISA, while ETA ,ETB and collagen levels were determined by Western blot. ANG II increased ET-1 peptide levels in a time-dependent manner reaching significance when incubated for 24 hours. NAD(P)H oxidase inhibitor, apocynin, as well as the superoxide scanverger, tempol, significantly reduced ANG Il-induced ET-1 peptide levels while over-expression of SOD1 (endogenous antioxidant enzyme) significantly decreased ANG Il-induced collagen I expression, therefore implicating reactive oxygen species in the mediation of ET-1. ANG II increased ETA receptor protein as well as collagen in a similar fashion, reaching significance after 4, 6, and 24 hours treatment. ANG II induced collagen was reduced while in the presence of the ETA receptor antagonist suggesting the role of the ETa receptor in the regulation of the extracellular matrix. ANG II treatment also increased ETB receptor protein levels in a time-dependent manner. ANG II treatment in the presence of the ETB receptor antagonist significantly increased ET-1 peptide levels. On another hand, the ETB receptor agonist, Sarafotoxin 6C, significantly decreased ET-1 peptide levels. These data implicate the role of the ETb receptor in the clearance of the ET-1 peptide. Conclusion: ANG II-induced increases of ET-1 peptide appears to be mediated by reactive oxygen species derived from NAD(P)H oxidase. Both the ETA and ETB receptors are expressed in adventitial fibroblasts. The ETA receptor subtype mediates collagen I expression, while the ETB receptor may play a protective role through increasing the clearance of the ET- 1 peptide.

The role of water in determining structure and function of macromolecules and macromolecular assemblies /

The interaction of biological molecules with water is an important determinant of structural properties both in molecular assemblies, and in conformation of individual macromolecules. By observing the effects of manipulating the activity of water (which can be accomplished by limiting its concentration or by adding additional solutes, "osmotic stress"), one can learn something about intrinsic physical properties of biological molecules as well as measure an energetic contribution of closely associated water molecules to overall equilibria in biological reactions. Here two such studies are reported. The first of these examines several species of lysolipid which, while present in relatively low concentrations in biomembranes, have been shown to affect many cellular processes involving membrane-protein or membrane-membrane interactions. Monolayer elastic constants were determined by combining X-ray diffraction and the osmotic stress technique. Spontaneous radii of curvature of lysophosphatidylcholines were determined to be positive and in the range +30A to +70A, while lysophosphatidylethanolamines proved to be essentially flat. Neither lysolipid significantly affected the bending modulus of the monolayer in which it was incorporated. The second study examines the role of water in theprocess of polymerization of actin into filaments. Water activity was manipulated by adding osmolytes and the effect on the equilibrium dissociation constant (measured as the criticalmonomer concentration) was determined. As water activity was decreased, the critical concentration was reduced for Ca-actin but not for Mg-actin, suggesting that 10-12 fewer water molecules are associated with Ca-actin in the polymerized state. Thisunexpectedly small amount of water is discussed in the context of the common structural motif of a nucleotide binding cleft.

The form and function of aggressive subtypes: Relations with the goodness of fit between adolescent temperament and parent personality

The current research investigated whether the interaction between adolescent temperament and parent personality, consistent with the goodness of fit perspective, differentially predicted overt (e.g., kicking, punching, insulting) and relational (e.g., gossiping, rumour spreading, ostracising) forms of reactive (e.g., provoked, a response to goal blocking, unplanned and emotional) and proactive (e.g., unprovoked, goal-directed, deliberate and relatively unemotional) aggression. Mothers, fathers and their adolescent child (N = 448, age 10-17) from southern Ontario, Canada filled out questionnaires on adolescent temperament (i.e., frustration, fear, and effortful control) and aggression. Parents reported on their own personality traits (i.e., agreeableness, conscientiousness, and emotional stability). The form and function of aggression not encompassed by the subtype under investigation were controlled in each regression analysis. Consistent with the hypothesis, results indicated that a poor fit between adolescent temperament vulnerabilities and lower parent personality traits, including agreeableness, conscientiousness and emotional stability, was predictive of greater levels of differentiated aggression. For instance, lower father conscientiousness strengthened the relation between higher frustration and reactive overt aggression. Unexpectedly in some cases, temperament risk factors were more strongly associated with aggression subtypes when personality scores were at higher levels, particularly agreeableness and conscientiousness, traits normally considered to be at the optimal end of the dimension. For example, higher father agreeableness strengthened the relation between higher frustration and reactive relational aggression. At the main effects level, low fearfulness was significantly associated with only the overt subtypes of aggression, and unexpectedly, higher frustration and lower effortful control were related to both proactive and reactive subtypes of aggression. A temperamentally vulnerable adolescent was also at greater risk of displaying aggressive behaviour when the father lacked emotional stability, but not the mother. These results are broadly consistent with the prediction that temperament risk factors are more strongly associated with aggression subtypes when an adolescent predisposition does not fit well with parent personality traits. Mechanisms pertaining to stress in the family environment and the fostering of self-regulation abilities are discussed with respect to why a poor fit between temperament and parent personality is predictive of adolescent differentiated aggression.

Novel glutathione disulfide transferase function of CC-glutaredoxins involved in disease resistance and flower development

Glutaredoxins are oxidoreductases capable of reducing protein disulfide bridges and glutathione mixed disulfides through the process of deglutathionylation and glutathionylation. Lately, redox-mediated modifications of functional cysteine residues of TGA1 and TGA8 transcription factors have been postulated. Namely, GRX480 and ROXY1 glutaredoxins have been previously shown to interact with TGA proteins and have been suggested to regulate redox state of these proteins. TGA1, together with TGA2, is involved in systemic acquired resistance (SAR) establishment in the plant Arabidopsis thaliana through PR1 (Pathogenesis related 1) gene activation. They both form an enhanceosome complex with the NPR1 protein (non-expressor of pathogenesis related gene 1) which leads to PR1 transcription. Although TGA1 is capable of activating PR1 transcription, the ability of the TGA1 NPR1 enhanceosome complex to assembly is based on the redox status of TGA1. We identified GRX480 as a glutathionylating enzyme that catalyzes the TGA1 glutathione disulfide transferase reaction with a Km of around 20μM GSSG (oxidized glutathione). Out of four cysteine residues found within TGA1, C172 and C266 were found to be glutathionylated by this enzyme. We also confirmed TGA1 glutathionylation in vivo and showed that this modification takes place while TGA1 is associated with the PR1 promoter enzymatically via GRX480. Furthermore, we show that glutathionylation via GRX480 abolishes TGA1's interaction with NPR1 and consequently prevents the TGA1-NPR1 transcription activation of PR1. When glutathionylated, TGA1 is recruited to the PR1 promoter and acts as a repressor. Therefore, glutathionylation is a mechanism that prevents TGA1 NPR1 interaction, allowing TGA1 to function as a repressor of PR1 transcription. Surprisingly, GRX480 was not able to deglutathionylate proteins demonstrating the irreversible nature of the reaction. Moreover, we demonstrate that other members of CC-class glutaredoxins, namely ROXY1 and ROXY2, can also catalyze protein glutathionylation. The TGA8 protein was previously shown to interact with NPR1 analogs, BOP1 and BOP2 proteins. However, unlike the case of TGA1 NPR1 interaction, here we demonstrate that TGA8-BOP1 interaction is not redox regulated and that TGA8 glutathionylation by ROXY1 and ROXY2 enzymes does not abolish this interaction in vitro. However, TGA8 glutathionylation results in TGA8 oligomer disassembly into smaller complexes and monomers. Our results suggest that CC-Grxs are unable to reduce mixed disulfides, instead they efficiently catalyze the opposite reaction which distinguishes them from traditional glutaredoxins. Therefore, they should not be classified as glutaredoxins but as protein glutathione disulfide transferases.

Examining peer-controlled KR schedules during the learning of a movement-timing task as a function of task experience.

Learners can be provided with feedback in the form of knowledge of results (KR), under self-controlled and peer-controlled schedules. Recently, McRae, Hansen, and Patterson (2015), identified that inexperienced peers can provide KR that can facilitate motor skill acquisition. However, it is currently unknown whether previous task experience differentially impacts how peers present learners with KR and whether this KR impacts motor skill acquisition. In the present study, participants were randomly assigned to become inexperienced peer facilitators, learners with an inexperienced peer, learners with self-control who later became experienced peers, learners with an experienced peer, or learners in a control group. During acquisition learners completed a serial-timing task with a goal of 2500ms and returned approximately twenty four hours later for a delayed retention, time transfer, and pattern transfer test. We predicted that during the delayed tests, learners with self-control would outperform all other groups. Furthermore, we predicted that learners who received KR from experienced peers would outperform learners who received KR from inexperienced peers. However, our results indicated that participants who received peer-controlled and self-controlled KR schedules learned the task in an equivalent manner. Thus, our results are novel as they identify that inexperienced peers can provide KR that is as effective as KR provided by experienced peers and KR requested under self-controlled conditions.

The Law-Finding Function of the American Jury

Article reprinted by permission of the Wisconsin Law Review. HARRINGTON Matthew P., "The Law-Finding Function of the American Jury", Copyright (1999) by The Board of Regents of the University of Wisconsin System.