999 resultados para Baker, Amy J. L
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The search for an ideal filler for soft tissue augmentation still continues. Because aging changes are continuous, temporary fillers should be preferred against permanent ones. Since 1999, the poly-L-lactic acid filler (PLA) has been marketed in Europe as Newfill. As a synthetic biocompatible polymer, PLA originally was used in suture materials and screws. In 2004, the U.S. Food and Drug Administration approved PLA under the name of Sculptra for the treatment of human immunodeficiency virus-related facial lipoatrophy. This study aimed to evaluate a 3-year follow-up investigation into the effect of PLA implant injection for the treatment of sunken nasolabial folds. Between October 2003 and February 2004, 10 women with a median age of 54 years (range, 43-60 years) were injected with polylactic acid hydrogel (Newfill) in the nasolabial fold area for aesthetic reasons. All the patients underwent three injections: one injection per month for 3 months. Evaluation of the results based on clinical examination and photography was performed at each session, at 6 months, and then 36 months after the third session. Injectable PLA was able to correct nasolabial folds successfully with a more lasting result than absorbable fillers commonly used in clinical practice, such as hyaluronic acid and collagen. Careful and standardized photographic documentation is indispensable.
Resumo:
The importance of lung tissue in asthma pathophysiology has been recently recognized. Although nitric oxide mediates smooth muscle tonus control in airways, its effects on lung tissue responsiveness have not been investigated previously. We hypothesized that chronic nitric oxide synthase (NOS) inhibition by N-omega-nitro-L-arginine methyl ester (L-NAME) may modulate lung tissue mechanics and eosinophil and extracellular matrix remodeling in guinea pigs with chronic pulmonary inflammation. Animals were submitted to seven saline or ovalbumin exposures with increasing doses (1 similar to 5 mg/ml for 4 wk) and treated or not with L-NAME in drinking water. After the seventh inhalation (72 h), animals were anesthetized and exsanguinated, and oscillatory mechanics of lung tissue strips were performed in baseline condition and after ovalbumin challenge (0.1%). Using morphometry, we assessed the density of eosinophils, neuronal NOS (nNOS)- and inducible NOS (iNOS)-positive distal lung cells, smooth muscle cells, as well as collagen and elastic fibers in lung tissue. Ovalbumin-exposed animals had an increase in baseline and maximal tissue resistance and elastance, eosinophil density, nNOS- and iNOS-positive cells, the amount of collagen and elastic fibers, and isoprostane-8-PGF(2 alpha) expression in the alveolar septa compared with controls (P < 0.05). L-NAME treatment in ovalbumin-exposed animals attenuated lung tissue mechanical responses (P < 0.01), nNOS- and iNOS-positive cells, elastic fiber content (P < 0.001), and isoprostane-8-PGF(2 alpha) in the alveolar septa (P < 0.001). However, this treatment did not affect the total number of eosinophils and collagen deposition. These data suggest that NO contributes to distal lung parenchyma constriction and to elastic fiber deposition in this model. One possibility may be related to the effects of NO activating the oxidative stress pathway.
Resumo:
Objective To report the occurrence of Myxobolus episquamalis in sea mullet, Mugil cephalus L, caught in estuaries in eastern and western Australia. Design A prospective study of commercial catches of mullet in the Clarence River of NSW and individual cases from other areas. Results The organism caused pale, white to pink, raised lesions on the scales and fins of sea mullet. Occurrence of infection was highest in spring and in a marine (down-river) environment compared to a brackish environment. Up to 6% of fish were affected in commercial catches. Conclusion The infection is widespread in Australian mullet, but rarely causes significant economic loss.
Resumo:
(ECHOCARDIOGRAPHY, Volume 26, September 2009).
Resumo:
We examined the role of cytokinins (CKs) in release of apical dominance in lateral buds of chickpea (Cicer arietinum L.). Shoot decapitation or application of CKs (benzyladenine, zeatin or dihydrozeatin) stimulated rapid bud growth. Time-lapse video recording revealed growth initiation within 2 h of application of 200 pmol benzyladenine or within 3 h of decapitation. Endogenous CK content in buds changed little in the first 2 h after shoot decapitation, but significantly increased by 6 h, somewhat later than the initiation of bud growth. The main elevated CK was zeatin riboside, whose content per bud increased 7-fold by 6 h and 25-fold by 24 h. Lesser changes were found in amounts of zeatin and isopentenyl adenine CKs. We have yet to distinguish whether these CKs are imported from the roots via the xylem stream or are synthesised in situ in the buds, but CKs may be part of an endogenous signal involved in lateral bud growth stimulation following shoot decapitation. To our knowledge, this is the first detailed report of CK levels in buds themselves during release of apical dominance.
Resumo:
Neural phase signaling has gained attention as a putative coding mechanism through which the brain binds the activity of neurons across distributed brain areas to generate thoughts, percepts, and behaviors. Neural phase signaling has been shown to play a role in various cognitive processes, and it has been suggested that altered phase signaling may play a role in mediating the cognitive deficits observed across neuropsychiatric illness. Here, we investigated neural phase signaling in two mouse models of cognitive dysfunction: mice with genetically induced hyperdopaminergia [dopamine transporter knock-out (DAT-KO) mice] and mice with genetically induced NMDA receptor hypofunction [NMDA receptor subunit-1 knockdown (NR1-KD) mice]. Cognitive function in these mice was assessed using a radial-arm maze task, and local field potentials were recorded from dorsal hippocampus and prefrontal cortex as DAT-KO mice, NR1-KD mice, and their littermate controls engaged in behavioral exploration. Our results demonstrate that both DAT-KO and NR1-KD mice display deficits in spatial cognitive performance. Moreover, we show that persistent hyperdopaminergia alters interstructural phase signaling, whereas NMDA receptor hypofunction alters interstructural and intrastructural phase signaling. These results demonstrate that dopamine and NMDA receptor dependent glutamate signaling play a critical role in coordinating neural phase signaling, and encourage further studies to investigate the role that deficits in phase signaling play in mediating cognitive dysfunction.
Resumo:
Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.
Resumo:
Non-astringent persimmon is rapidly expanding as a new fruit crop in warm subtropical regions of the world, Most research and development of this fruit crop has occurred in Japan, where there is a considerable amount of published literature on its performance. Much of this information is not readily accessible to other countries and needs to be interpreted and modified for other climatic regions. This paper reviews reproductive events from floral initiation to the completion of fruit growth. The timing and significance of these events is described in relation to the phenological cycle. Method of improving flowering, reducing fruit drop and altering the fruit maturity period are discussed. (C) 1997 Elsevier Science B.V.
Resumo:
There is a considerable interindividual variation in L-thyroxine [ 3,5,3`,5`-tetraiodo-l-thyronine (T(4))] dose required for thyrotropin (thyroid-stimulating hormone) suppression in patients with differentiated thyroid cancer. To investigate whether uridine diphosphate-glucuronosyl transferase 1A1 (UGT1A1)-mediated T(4) glucuronidation in liver affects T(4) dose, we genotyped 101 patients for the common UGT1A1-53(TA)(n) polymorphism and compared T(4) doses among patients having zero (5/6 and 6/6 genotypes), one (6/7 genotype), or two (7/7 and 7/8 genotypes) copies of the low-expression (TA) 7 and (TA) 8 alleles. A significant trend for decreasing T(4) dose with increasing number of copies of (TA)(7) and (TA)(8) (P = 0.037) and significant difference in T(4) dose across the UGT1A1-53(TA)(n) genotypes (P = 0.048) were observed, despite considerable overlap of T(4) doses among different genotypes. These results are consistent with reduced T(4) glucuronidation in patients with low-expression (TA) 7 and (TA) 8 alleles and provide the first evidence for association between UGT1A1-53(TA)(n) and T(4)-dose requirement for thyroid-stimulating hormone suppression in a natural clinical setting. Pharmacogenetics and Genomics 21: 341-343 (C) 2011 Wolters Kluwer Health | Lippincott Williams & Wilkins. Pharmacogenetics and Genomics 2011, 21: 341-343