1000 resultados para Andral, Gr


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The value of a seasonal forecasting system based on phases of the Southern Oscillation was estimated for a representative dryland wheat grower in the vicinity of Goondiwindi. In particular the effects on this estimate of risk attitude and planting conditions were examined. A recursive stochastic programming approach was used to identify the grower's utility-maximising action set in the event of each of the climate patterns over the period 1894-1991 recurring In the imminent season. The approach was repeated with and without use of the forecasts. The choices examined were, at planting, nitrogen application rate and cultivar and, later in the season, choices of proceeding with or abandoning each wheat activity, The value of the forecasting system was estimated as the maximum amount the grower could afford to pay for its use without expected utility being lowered relative to its non use.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Numerous studies investigating the possible role of altered Ca2+ homeostasis in hypertension have compared resting and agonist-stimulated intracellular free Ca2+ ([Ca2+](i)) in cultured aortic smooth muscle cells from spontaneously hypertensive (SHR) and normotensive Wistar-Kyoto (WKY) rats. However, such studies have not given consistent results. Differences in the method used to load cells with the Ca2+-sensitive indicator fura-2 have been investigated here as a possible source of variability between studies. We also describe the adaptation of a fluorescence technique for the assessment of basal Ca2+ permeability in SHR and WKY through the measurement of Mn2+ influx. The results are consistent with the hypothesis that basal Ca2+ influx is elevated in cultured aortic smooth muscle cells from SHR compared to those from WKY. However, this was not reflected as a significant difference between the two strains in basal or angiotensin II (200 nmol/L)stimulated [Ca2+](i). Furthermore, this result was not dependent on the protocol used to load cells with fura-2. Hence, measurement of bulk [Ca2+](i) does not appear to be the most sensitive parameter for altered Ca2+ homeostasis in SHR. Other compartments of the cell may better reflect altered Ca2+ fluxes in hypertension and are discussed in this work.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Propylthiouracil (PTU) is widely believed to cross the placenta less freely than methimazole (MMI) and is therefore regarded as the preferred drug for treatment of hyperthyroidism in pregnancy. Clinical studies comparing the two drugs show, however, no differences in maternal or fetal thyroid function. We investigated transfer from the maternal to the fetal circuit in the isolated perfused term human placental lobule of low and high doses of PTU (4 mu g/mL and 40 mu g/mL) and MMI(1.5 mu g/mL and 15 mu g/mL) in protein-free perfusate and low doses of both drugs with addition of 40 g/L of bovine albumin. Both drugs readily crossed the placenta, reaching equilibrium in all experiments in about 2 h. Drug concentrations in the two circuits fitted a two compartmental model. Transfer kinetics for the two drugs were similar, nonsaturable, and unaffected by addition of albumin. Clearances (mL.min(-1).g(-1), means +/- SD) of PTU from maternal to fetal circuits were: 0.229 +/- 0.110, 0.216 +/- 0.065, and 0.170 +/- 0.032; and for transfer of MMI: 0.165 +/- 0.025, 0.232 +/- 0.153, and 0.174 +/- 0.009 (for low doses without, low doses with, and high doses without albumin, respectively). Clearances of PTU from fetal to maternal circuits were: 0.147 +/- 0.072, 0.109 +/- 0.014, and 0.116 +/- 0.028; and for transfer of MMI: 0.095 +/- 0.029, 0.122 +/- 0.088, and 0.12 +/- 0.005 (in the same experiments). There was no significant difference between drugs or drug doses and no effect of addition of albumin. We conclude that PTU and MMI have similar placental transfer kinetics.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Protein, amino acids and ammonium were the main forms of soluble soil nitrogen in the soil solution of a subtropical heathland (wallum). After fire, soil ammonium and nitrate increased 90- and 60-fold, respectively. Despite this increase in nitrate availability after fire, wallum species exhibited uniformly low nitrate reductase activities and low leaf and xylem nitrate, During waterlogging soil amino acids increased, particularly gamma-aminobutyric acid (GABA) which accounted for over 50% of amino nitrogen. Non-mycorrhizal wallum species were significantly (P < 0.05) N-15-enriched (0.3-4.3 parts per thousand) compared to species with mycorrhizal associations (ericoid-type, ecto-, va-mycorrhizal) which were strongly depleted in N-15 (-6.3 to -1.8 parts per thousand). Lignotubers and roots had delta(15)N signatures similar to that of the leaves of respective species. The exceptions were fine roots of ecto-, ecto/va-, and ericoid type mycorrhizal species which were enriched in N-15 (0.1-2 4 parts per thousand). The delta(15)N signatures of delta(15)N(total soil N) and delta(15)N(soil NH4+) were in the range 3.7-4.5 parts per thousand, whereas delta(15)N(soil NO3-) was significantly (P < 0.05) more enriched in N-15 (9.2-9.8 parts per thousand). It is proposed that there is discrimination against N-15 during transfer of nitrogen from fungal to plant partner. Roots of selected species incorporated nitrogen sources in the order of preference: ammonium > glycine > nitrate. The exception were proteoid roots of Hakea (Proteaceae) which incorporated equal amounts of glycine and ammonium.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pain is the most conspicuous symptom observed in patients wounded by stingrays, and skin necrosis is common in accidents by freshwater stingrays. The extract from the stinger integumentary tissue of Potamotrygon falkneri containing toxic components (venom) was tested for its ability to induce histopathological changes in the dorsal skin of mice at different times. 3-6 h after injection, foci of necrosis in isolated basal epidermal cells were observed. Full coagulative necrosis of the skin, subcutaneous tissue and skeletal muscle was evident as soon as 24 h after venom exposure, with a clear demarcation from the normal skin. After 48 h, round collections of necrotic cells start to coalesce originating extensive skin necrotic plaques that detach from viable tissue after 72-96 h. Inflammatory infiltrate was observed after 6 h, but was always mild. Acute vascular thrombosis was rare, and hemorrhage was not present at any time. Superficial bacterial infection was present in two of the examined cases. In conclusion, the venom of P. falkneri is responsible for the development of an early necrosis with mild inflammatory reaction, probably due to direct action of the venom. The severe local damage is probably worsened by the mechanical trauma caused by the stinger. (c) 2010 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Borges GR, Salgado HC, Silva CA, Rossi MA, Prado CM, Fazan R Jr. Changes in hemodynamic and neurohumoral control cause cardiac damage in one-kidney, one-clip hypertensive mice. Am J Physiol Regul Integr Comp Physiol 295: R1904-R1913, 2008. First published October 1, 2008; doi:10.1152/ajpregu.00107.2008.-Sympathovagal balance and baroreflex control of heart rate (HR) were evaluated during the development (1 and 4 wk) of one-kidney, one-clip (1K1C) hypertension in conscious mice. The development of cardiac hypertrophy and fibrosis was also examined. Overall variability of systolic arterial pressure (AP) and HR in the time domain and baroreflex sensitivity were calculated from basal recordings. Methyl atropine and propranolol allowed the evaluation of the sympathovagal balance to the heart and the intrinsic HR. Staining of renal ANG II in the kidney and plasma renin activity (PRA) were also evaluated. One and four weeks after clipping, the mice were hypertensive and tachycardic, and they exhibited elevated sympathetic and reduced vagal tone. The intrinsic HR was elevated only 1 wk after clipping. Systolic AP variability was elevated, while HR variability and baroreflex sensitivity were reduced 1 and 4 wk after clipping. Renal ANG II staining and PRA were elevated only 1 wk after clipping. Concentric cardiac hypertrophy was observed at 1 and 4 wk, while cardiac fibrosis was observed only at 4 wk after clipping. In conclusion, these data further support previous findings in the literature and provide new features of neurohumoral changes during the development of 1K1C hypertension in mice. In addition, the 1K1C hypertensive model in mice can be an important tool for studies evaluating the role of specific genes relating to dependent and nondependent ANG II hypertension in transgenic mice.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Depressed patients have reduced glucocorticoid receptor (GR) function, as demonstrated by resistance to the suppressive effects of the synthetic glucocorticoid hormone, and GR agonist, dexamethasone. We have developed a suppressive test with prednisolone, a synthetic glucocorticoid that is similar to cortisol in its pharmacodynamics and pharmacokinetics, and binds to both the GR and the mineralocorticoid receptor (MR). We have found that depressed patients suppress normally to prednisolone, unless they are particularly non-responsive to treatment. In the present study, we evaluated 28 inpatients with treatment-resistant depression (TRD), and compared salivary cortisol secretion (at 0900 h, 1200 h and 1700 h) after placebo or after prednisolone (5 mg), before and after an inpatient treatment admission. Half of the patients (n = 14) reached treatment response. When comparing the assessment between admission and discharge, cortisol output after placebo fell (-26% of area under the curve; p = 0.024) while the output after prednisolone did not change. Moreover, there was no change in the response to prednisolone (percentage suppression) between admission at discharge, and this was not influenced by treatment response. Finally, we could confirm and extend our previously published data with prednisolone (5 mg), showing that depressed patients (n = 12) and controls (n = 12) suppressed equally to both 5 and 10 mg doses of prednisolone. This study suggests that the response to prednisolone is similar in depressed patients and controls at different doses of prednisolone, and does not change with symptomatic improvement. This is in contrast with findings, from us and others, using other measures of hypothalamic-pituitary-adrenal axis function, such as basal cortisol levels or the response to dexamethasone. Thus, we propose that the prednisolone suppression test may offer specific biological and clinical information, related to its action at both the GR and the MR. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: To correlate clinical prognosis of patients with nasal polyps to the expression of p65, c-Fos, GR alpha and GR beta. Methods: A biopsy was obtained at the first evaluation of patients with nasal polyps, and at rhinoplasty for control mucosa. Patients with nasal polyps were treated with glucocorticoids and followed for at least 60 months. The expression of p65, c-Fos, GR alpha and GR beta was determined by Real Time-PCR and correlated to clinical outcome. The end-point of resistance to glucocorticoid therapy was considered when surgery was indicated. Results: Patients with nasal polyps presented a higher expression of p65, a lower expression of GR alpha, and a lower GR alpha/GR beta ratio than control mucosa. The patients with nasal polyps who had a higher expression of p65 correlated with a poorer response to glucocorticoids, with a 3.5-fold higher risk for surgery. Conclusion: Patients with a higher p65 (NF-kappa B) expression at diagnosis were associated to a worse response to clinical treatment, suggesting one of the mechanisms of cell resistance to glucocorticoid treatment in patients with nasal polyps.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cell resistance to glucocorticoids is a major problem in the treatment of nasal polyposis (NP). The objectives of this study were to observe the effect of budesonide on the expression of IL-1 beta, TNF-alpha, granulocyte macrophage-colony stimulating factor, intercellular adhesion molecule (ICAM)-1, basic fibroblast growth factor, eotaxin-2, glucocorticoid receptor (GR)-alpha, GR-beta, c-Fos and p65 in nasal polyps and to correlate their expression to clinical response. Biopsies from nasal polyps were obtained from 20 patients before and after treatment with topical budesonide. Clinical response to treatment was monitored by a questionnaire and nasal endoscopy. The mRNA levels of the studied genes were measured by real-time quantitative (RQ)-PCR. There was a significant decrease in the expression of TNF-alpha (P < 0.05), eotaxin-2 (P < 0.05) and p65 (P < 0.05) in NP after treatment. Poor responders to glucocorticoids showed higher expression of IL-1 beta (3.74 vs. 0.14; P < 0.005), ICAM-1 (1.91 vs. 0.29; P < 0.05) and p65 (0.70 vs. 0.16; P < 0.05) before treatment. Following treatment, IL-1 beta (4.18 vs. 0.42; P < 0.005) and GR-beta (0.95 vs. 0.28; P < 0.05) mRNA expression was higher in this group. Topical budesonide reduced the expression of TNF-alpha, eotaxin-2 and p65. Poor responders to topical budesonide exhibit higher levels of IL-1 beta, ICAM-1 and nuclear factor (NF)-kappa B at diagnosis and higher expression of both IL-1 beta and GR-beta after treatment. These results emphasize the anti-inflammatory action of topical budesonide at the molecular level and its importance in the treatment of NP. Nevertheless, IL-1 beta, ICAM-1 and NF-kappa B may be associated with primary resistance to glucocorticoids in NP, whereas higher expression of GR-beta in poor responders only after glucocorticoid treatment may represent a secondary drug resistance mechanism in this disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study examines in vitro steroid sensitivity in chronic renal failure ( CRF) patients and its influence on the allograft outcome. We determined the inhibitory effect of dexamethasone ( DEX) on concanavalin A ( Con-A)-stimulated peripheral blood mononuclear cell ( PBMC) proliferation, and glucocorticoid receptor` ( GR) number of binding sites ( B-max) and affinity ( K-d) in 28 CRF patients and 40 normal healthy controls. Based on K-d values > 95th percentile from controls, patients were divided into two groups: glucocorticoid resistant ( n = 11) and glucocorticoid sensitive ( n = 17). Patients were followed during 18 months post-transplantation observing acute rejection episodes ( ARE), chronic allograft nephropathy ( CAN), allograft failure and death. The DEX concentration that caused 50% inhibition of Con-A-stimulated PBMC proliferation ( IC50) was higher in CRF than in healthy controls ( 2.2 x 10(-5) +/- 1.0 x 10(-5) versus 8.3 x 10(-6) +/- 4.2 x 10(-6) mol/ L, P = 0.02). Values of Kd ( 12.4 +/- 1.8 versus 7.2 +/- 0.9 nM) and Bmax ( 7.7 +/- 1.1 versus 4.1 +/- 0.3 fmol/ mg protein) were higher in CRF patients ( P = 0.02 and P = 0.001, respectively). There were higher incidences of ARE ( P = 0.02) and CAN ( P = 0.002) in the glucocorticoid-resistant group. Univariate and multivariate logistic regression showed that Kd was an independent predictor of ARE ( OR 8.8, P= 0.03) aswell as of CAN ( OR 16.5, P= 0.01). In conclusion, we observed glucocorticoid resistance in a subgroup of CRF patients undergoing dialysis, which led to a higher morbidity due to ARE and CAN in an 18-month follow-up period.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study, we report the protective effects of IAA on diethylnitrosamine (DEN)-induced hepatocarcinogenesis. BALB/c mice received daily IAA at 50 (T(50)), 250 (T(250)), and 500 (T(500)) mg K(-1) per body mass by gavage for 15 days. At day 15, animals were administered DEN and sacrificed 4 h later. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were analyzed in sera. In addition., hepatomorphologic alterations, activity of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), and glutathione reductase (GR), gene expression of antioxidant enzymes and DNA integrity were evaluated in the liver. IAA administration did not show any alterations in any of the parameters available, except for a reduction of the gene expression for antioxidant enzyrries by 55, 56, 27, and 28% for SOD, CAT, GPx, and GR upon T(500). respectively compared with the control. Several hepatic alterations were observed by DEN exposure. Moreover, IAA administration at 3 doses was shown to provide a total prevention of the active reduction of CAT and GR induced by DEN exposure compared with the control. IAA at T5(00) was shown to give partial protection (87, 71, 57, and 90% for respectively SOD, CAT. GPx. and GR) on the down-regulation of the enzymes induced by DEN and this auxin showed a partial protection (50%) on DEN-induced DNA fragmentation for both parameters when compared to DEN alone. This work showed IAA hepatocarcinogenesis protection for the first time by means of a DEN-protective effect on CAT and GR activity. and by affecting antioxidant gene expression and DNA fragmentation. Copyright (C) 2008 John Wiley & Sons, Ltd.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The activity of the hypothalamic-pituitary-adrenal axis is modulated by the norepinephrinergic system and, in females, also by the ovarian hormones. We investigated the role of ovarian steroids and the locus coeruleus (LC) on stress-induced corticosterone secretion in female rats. Ovariectomized rats without hormonal replacement (OVX) or treated with estradiol (OVE) or estradiol plus progesterone (OVEP) were subjected to jugular cannulation. Immediately after that, each hormonal treatment group was subjected to LC lesion or sham surgery or no brain surgery. After 24 h, blood samples of all 9 groups were collected before and after ether inhalation. Other four groups (OVX control, sham and lesioned, and OVE) were perfused for glucocorticoid receptor (GR) immunocytochemistry in hippocampal CA1 neurons and paraventricular nucleus (PVN). Estradiol replacement decreased while LC lesions increased stress-induced corticosterone secretion. The effect of LC lesion was potentiated with the removal of ovarian steroids. Since GR expression of lesioned animals decreased in the hippocampus, but not in PVN, we suggest that the effect of LC lesion on corticosterone secretion could be due to a reduction in the efficiency of the negative feedback system in the CA1 neurons. However, this mechanism is not involved in the estradiol modulation on corticosteroid secretion, as no change in GR expression was observed in estradiol-treated animals.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study, we have compared the effector functions and fate of a number of human CTL clones in vitro or ex vivo following contact with variant peptides presented either on the cell surface or in a soluble multimeric format. In the presence of CD8 coreceptor binding, there is a good correlation between TCR signaling, killing of the targets, and Fast-mediated CTL apoptosis. Blocking CD8 binding using (alpha3 domain mutants of MHC class I results in much reduced signaling and reduced killing of the targets. Surprisingly, however, Fast expression is induced to a similar degree on these CTLs, and apoptosis of CTL is unaffected. The ability to divorce these events may allow the deletion of antigen-specific and pathological CTL populations without the deleterious effects induced by full CTL activation.